ID: 1027946743

View in Genome Browser
Species Human (GRCh38)
Location 7:84756827-84756849
Sequence AACTCACAAGAGACTTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027946738_1027946743 14 Left 1027946738 7:84756790-84756812 CCATCAAGCTTCGTGGGTATCAG No data
Right 1027946743 7:84756827-84756849 AACTCACAAGAGACTTACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027946743 Original CRISPR AACTCACAAGAGACTTACGT GGG Intergenic
No off target data available for this crispr