ID: 1027956812

View in Genome Browser
Species Human (GRCh38)
Location 7:84888488-84888510
Sequence ATGTTGCCATTCAAGATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027956812_1027956813 28 Left 1027956812 7:84888488-84888510 CCTTATATCTTGAATGGCAACAT No data
Right 1027956813 7:84888539-84888561 GCATCCCTTCAACTAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027956812 Original CRISPR ATGTTGCCATTCAAGATATA AGG (reversed) Intergenic
No off target data available for this crispr