ID: 1027963023

View in Genome Browser
Species Human (GRCh38)
Location 7:84970787-84970809
Sequence AAGGAACTATTGAAATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027963020_1027963023 11 Left 1027963020 7:84970753-84970775 CCAGGAAATATATTGTATAATTT No data
Right 1027963023 7:84970787-84970809 AAGGAACTATTGAAATCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027963023 Original CRISPR AAGGAACTATTGAAATCTTG TGG Intergenic
No off target data available for this crispr