ID: 1027963088

View in Genome Browser
Species Human (GRCh38)
Location 7:84971766-84971788
Sequence CTCTTTGCTAAGTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027963088_1027963092 24 Left 1027963088 7:84971766-84971788 CCCTCCTCAAACTTAGCAAAGAG No data
Right 1027963092 7:84971813-84971835 CTCATTCCAAAAACAGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027963088 Original CRISPR CTCTTTGCTAAGTTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr