ID: 1027963092

View in Genome Browser
Species Human (GRCh38)
Location 7:84971813-84971835
Sequence CTCATTCCAAAAACAGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027963091_1027963092 1 Left 1027963091 7:84971789-84971811 CCTTTATTTGATATTTATTTGAT No data
Right 1027963092 7:84971813-84971835 CTCATTCCAAAAACAGCAATTGG No data
1027963089_1027963092 23 Left 1027963089 7:84971767-84971789 CCTCCTCAAACTTAGCAAAGAGC No data
Right 1027963092 7:84971813-84971835 CTCATTCCAAAAACAGCAATTGG No data
1027963090_1027963092 20 Left 1027963090 7:84971770-84971792 CCTCAAACTTAGCAAAGAGCCTT No data
Right 1027963092 7:84971813-84971835 CTCATTCCAAAAACAGCAATTGG No data
1027963088_1027963092 24 Left 1027963088 7:84971766-84971788 CCCTCCTCAAACTTAGCAAAGAG No data
Right 1027963092 7:84971813-84971835 CTCATTCCAAAAACAGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027963092 Original CRISPR CTCATTCCAAAAACAGCAAT TGG Intergenic
No off target data available for this crispr