ID: 1027966086

View in Genome Browser
Species Human (GRCh38)
Location 7:85010458-85010480
Sequence CTCTTCAGTAGCTACTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027966086_1027966088 -3 Left 1027966086 7:85010458-85010480 CCAGTGAAGTAGCTACTGAAGAG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1027966088 7:85010478-85010500 GAGCTACTGTGGCCTCAGTTAGG No data
1027966086_1027966093 27 Left 1027966086 7:85010458-85010480 CCAGTGAAGTAGCTACTGAAGAG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG No data
1027966086_1027966091 10 Left 1027966086 7:85010458-85010480 CCAGTGAAGTAGCTACTGAAGAG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1027966091 7:85010491-85010513 CTCAGTTAGGCTGGCATCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 140
1027966086_1027966092 11 Left 1027966086 7:85010458-85010480 CCAGTGAAGTAGCTACTGAAGAG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1027966092 7:85010492-85010514 TCAGTTAGGCTGGCATCTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1027966086_1027966089 1 Left 1027966086 7:85010458-85010480 CCAGTGAAGTAGCTACTGAAGAG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1027966089 7:85010482-85010504 TACTGTGGCCTCAGTTAGGCTGG 0: 1
1: 0
2: 2
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027966086 Original CRISPR CTCTTCAGTAGCTACTTCAC TGG (reversed) Intronic
902111282 1:14080585-14080607 TCCTTCAGTACCTACTTCATTGG + Intergenic
903987033 1:27235549-27235571 CTATTCAGTACCCACTTCAAAGG + Intronic
905283186 1:36861999-36862021 CTATTCAATGCCTACTTCACAGG - Intronic
905790426 1:40786391-40786413 CTCTCCAGGAGCTAATCCACTGG + Intronic
912983569 1:114402932-114402954 CTCTAGAGAAGCTACTTCCCTGG + Intronic
1064791827 10:18965527-18965549 CTCTTCAGTAGCTCATTCTCAGG + Intergenic
1065449307 10:25839585-25839607 TTCTTCAAAAGCTACTGCACAGG + Intergenic
1068383918 10:56298574-56298596 CTCTTCTGTAAGTACTTCACTGG + Intergenic
1070463803 10:76698028-76698050 CTTTTCAGTAGATACTTAATTGG - Intergenic
1072028262 10:91487449-91487471 CTCTGCAGAAGCTACATCAAAGG - Intronic
1072329574 10:94334219-94334241 CGATTCAGTAGCAACTTCACTGG + Exonic
1072543359 10:96414959-96414981 CTTTCCAGTAGCTTCTTAACTGG + Intronic
1072935349 10:99706875-99706897 CTAGTCAGAAGCTACTTCACTGG + Intronic
1074114154 10:110443209-110443231 CTATTCAGTAGCTTCTTGCCAGG - Intergenic
1074410333 10:113222720-113222742 TTCTTCAGTAACTACTTCGCAGG + Intergenic
1078872281 11:15359508-15359530 CTCTTCAGCAGCTCCTACAAAGG + Intergenic
1083058483 11:59845853-59845875 CTTTTTAGTAACTACTTCACTGG + Intergenic
1084405079 11:68967326-68967348 CAATTCAGCAGCTCCTTCACAGG - Intergenic
1084838622 11:71826578-71826600 CTCTTCAGATGCTCCTTCTCTGG + Intergenic
1088585726 11:111358834-111358856 CTCCTCAGCAGTTCCTTCACTGG + Exonic
1089787639 11:120919677-120919699 TTATTCAGTAGCTTCTGCACTGG - Intronic
1090476377 11:127025309-127025331 ATCTATGGTAGCTACTTCACAGG + Intergenic
1090898932 11:131008076-131008098 TTCTTCAGTATCCTCTTCACTGG + Intergenic
1091487922 12:907630-907652 CTCTTCAGTAGCTGCTGCTAAGG - Intronic
1093006684 12:14058901-14058923 TGCTTCAGATGCTACTTCACTGG + Intergenic
1095223416 12:39647595-39647617 CTCTTCAGTATAGCCTTCACTGG + Intronic
1095646721 12:44556657-44556679 CTCTCCAGCAGCTAGTTCAGGGG + Intronic
1097530863 12:60798428-60798450 CTCTTCAGTGGATTCTTAACAGG - Intergenic
1097923199 12:65099410-65099432 ATCTTCTGTAGCCACTTCAAAGG - Intronic
1098526526 12:71493232-71493254 CTCTTCAATAGTTACTTCTAGGG - Intronic
1099687973 12:85913552-85913574 CTTTTCAGTGGGAACTTCACAGG + Intergenic
1100360956 12:93878820-93878842 CTCTTCAGTGGCTCTTTCATCGG + Intronic
1106699023 13:32209055-32209077 CTCTCCAGAAGCCACGTCACTGG + Exonic
1110137781 13:72089703-72089725 TTCTTCATTAGCTGCTTCTCAGG + Intergenic
1115975786 14:38995498-38995520 CTCTTCAAAAGCGACTTCCCCGG + Intergenic
1117061162 14:51965279-51965301 CCTTTCAGTAGTTACTTGACAGG + Intronic
1118002764 14:61538942-61538964 CTCTTCAGTAGCTACATTTGGGG + Intronic
1119834794 14:77738966-77738988 CTCTTTAATAGCTTCTTCATCGG + Exonic
1127379117 15:58413851-58413873 TTCTTAATTATCTACTTCACTGG - Intronic
1128667270 15:69547687-69547709 CTCACCAGTAGCTAATTCAAGGG + Intergenic
1132722898 16:1325732-1325754 CTCTTCAGTGGCCAGGTCACAGG + Exonic
1133186791 16:4105722-4105744 CTCTTCAGTAGCTAGGACACAGG - Intronic
1137015695 16:35372166-35372188 CTCTTGAGTAGCTAGAACACAGG - Intergenic
1141138556 16:81482523-81482545 CTCTCCAGAAGCTACTTAGCAGG - Intronic
1144131316 17:12250205-12250227 CTCTGCAGTTGCTGCTTCTCTGG + Intergenic
1148670196 17:49404508-49404530 CTCTTCAGCAGCATCTGCACAGG + Exonic
1152899220 17:82930430-82930452 CTCTTCAGCAGATGCTTGACCGG + Intronic
1152902403 17:82950437-82950459 CTCTTCAGGATCTACTTCTCAGG - Intronic
1155311477 18:24528429-24528451 CTCTTCAATTTCTTCTTCACCGG - Intergenic
1158454025 18:57591056-57591078 CTCCTCAGTAGCTGGTTTACAGG - Intergenic
1159068083 18:63591551-63591573 CACTTGAGTAGCTACTATACTGG - Intronic
1160191985 18:76722304-76722326 TTATTCAGCAGCTCCTTCACAGG - Intergenic
1163831082 19:19547467-19547489 CTCTGCACTAGCAACTTCAGGGG + Intergenic
1164784310 19:30917837-30917859 CTCTTCAGCAGCTGTTTCACGGG + Intergenic
1164931790 19:32181631-32181653 CTCTTGAGTGGCCACTTCCCGGG - Intergenic
1166132265 19:40753040-40753062 TTCTTCAACAGCAACTTCACTGG - Intronic
1166458359 19:42963961-42963983 CTCTTCATTAGAAACTTCTCGGG + Intronic
1168214557 19:54915876-54915898 CTTTTCAGTATCTGCTTTACTGG + Intronic
925503502 2:4533786-4533808 CTCATCTGTACCTACTTCACAGG - Intergenic
925886466 2:8397515-8397537 CTGTCCAGCAGCTACCTCACCGG + Intergenic
926363473 2:12112009-12112031 CTCCTCAGTAGCTTCTCCACTGG + Intergenic
930851806 2:55969152-55969174 CTCTTTAGTTGCTACTTTAATGG - Intergenic
936376922 2:111948750-111948772 CTCTGCAGTAGCTTCCTAACTGG + Intronic
936511061 2:113147628-113147650 CTGTTCAGTAGAAACTTCACAGG - Intergenic
938972315 2:136443674-136443696 ATCTCCTGTAGCTTCTTCACTGG + Intergenic
940481900 2:154243235-154243257 ATCTACAGTACCTACCTCACAGG - Intronic
941117028 2:161483525-161483547 TTCTTAATTTGCTACTTCACCGG - Intronic
941897405 2:170643333-170643355 GTCTTCAGAAGCTATTTCATGGG + Intronic
944377121 2:199058530-199058552 CTCTTCAGTACCTTTTTCAATGG - Intergenic
944440454 2:199738008-199738030 CTCTCCATTAACTGCTTCACTGG + Intergenic
945369659 2:209001340-209001362 ATGTTTAGTAGCTACTGCACAGG - Intergenic
1168832582 20:854714-854736 CTGCTCAGTAGCTACTTTACTGG + Intronic
1172584184 20:36071031-36071053 CCCTTCTGTCCCTACTTCACTGG + Intergenic
1173847697 20:46198480-46198502 CTCCTCTGTAGCTACTGCCCTGG + Intronic
1173912569 20:46681183-46681205 CTCTTCACTCACTCCTTCACTGG - Intronic
1174678584 20:52381944-52381966 CTCTGTAGTACCTACTTCATAGG + Intergenic
1178732314 21:35116030-35116052 CTCTTCTGTGGCCACTTCACGGG + Intronic
1181777397 22:25169597-25169619 CACTTCAGTGGCCACATCACAGG + Intronic
1182139270 22:27938816-27938838 CTCTTCAGTAGCTGGATTACAGG - Intergenic
1183253224 22:36744655-36744677 GTCTTCAGTAGCTGCTTCCTTGG + Intergenic
1184990295 22:48163732-48163754 CTCTTCAATAACTACCTCCCAGG - Intergenic
949895559 3:8765540-8765562 CTCTCCAGTATCTACTCCAAAGG + Intronic
951097074 3:18644660-18644682 CTGTTCTGCAGCCACTTCACTGG + Intergenic
952170509 3:30801564-30801586 CTCTTCCATAGCTCTTTCACTGG - Intronic
954334559 3:49908782-49908804 CTCCTCCGTAGCTCCTGCACAGG - Intronic
959408602 3:105993489-105993511 CTTTTCAGTGGAAACTTCACAGG - Intergenic
963672179 3:148265275-148265297 CACCTCACTAACTACTTCACAGG + Intergenic
963692452 3:148521077-148521099 CTCTTCACTAGAAACTTTACAGG + Intergenic
965354659 3:167658777-167658799 CACTTCAGCATCAACTTCACAGG + Intergenic
965809813 3:172579667-172579689 GCCTTGAGTAGCTTCTTCACAGG - Intergenic
965996804 3:174893106-174893128 CTCTTCAGTGGAAACTTTACAGG + Intronic
967399166 3:189041459-189041481 CTCTTTAGCACGTACTTCACAGG + Intronic
969133575 4:5011493-5011515 CTCTTCAGCAACTACTGCATTGG + Intergenic
975645383 4:76541055-76541077 CTTTTCAGTAACTACATCAGTGG - Intronic
976821352 4:89210719-89210741 CTTTTCAGTTTCTCCTTCACTGG - Intergenic
978129396 4:105176633-105176655 CTCTTCATTATTTAGTTCACTGG - Intronic
981895241 4:149790757-149790779 CTCCTCTGTCGCTATTTCACAGG - Intergenic
985647522 5:1091985-1092007 CTCTTCAGAAGCTGCATCTCTGG - Intronic
986985259 5:13493877-13493899 CACTACAATAGCTCCTTCACTGG - Intergenic
988531352 5:32030037-32030059 GTATTCAGTAGCTTCTTGACTGG + Intronic
989520221 5:42392619-42392641 GTCTTGAGAAGCTCCTTCACAGG + Intergenic
990881592 5:60544915-60544937 TGCTTCTGGAGCTACTTCACTGG - Intergenic
991468110 5:66936372-66936394 CTGTTCAGTAGTCTCTTCACAGG - Intronic
991693462 5:69248272-69248294 CTTTTCAGTAGAAACTTTACAGG - Intronic
991977754 5:72199687-72199709 TTCTTCAGTGGGTTCTTCACTGG - Exonic
992015989 5:72575744-72575766 TTCTTCAGTGCCTTCTTCACAGG + Intergenic
992298691 5:75354657-75354679 CTCTCCAGTACCTACCTTACAGG + Exonic
994581649 5:101650088-101650110 CACTTCAGTTGCTTCTTCAGAGG - Intergenic
995168277 5:109074269-109074291 CTTTTCAGTTGCTACTTGTCAGG + Intronic
996431790 5:123388580-123388602 TTCTTCTGTACCTGCTTCACTGG - Exonic
998189900 5:140014697-140014719 TTCTTCAGTGGCTACCTAACTGG + Intronic
1000271522 5:159688690-159688712 CTTTTCAGTGGAAACTTCACAGG + Intergenic
1000930230 5:167242732-167242754 GTCTTCATTAGCTACGTTACTGG + Intergenic
1006124229 6:31827427-31827449 CCCTTCAGTAGGTAATTGACAGG - Intergenic
1008020509 6:46572504-46572526 CTTTTCAGGAGAAACTTCACAGG - Intronic
1011613845 6:89180165-89180187 CTCTCCTGTGCCTACTTCACAGG - Intronic
1014177079 6:118342665-118342687 CCCTCCAGTAGCTACACCACCGG - Intergenic
1018093965 6:160368414-160368436 GTCTTCAGTCTCTCCTTCACTGG + Intronic
1019054031 6:169207606-169207628 CTTTTCAGCAGAAACTTCACAGG + Intergenic
1021550922 7:21870022-21870044 CTCGTCAGTAGGCAATTCACAGG + Intronic
1024155325 7:46616774-46616796 CTCTTGAGTAAGAACTTCACTGG - Intergenic
1024941653 7:54769063-54769085 CTCCTCAGTAGCTAGGACACAGG - Intergenic
1026078189 7:67192474-67192496 GTATGCAGTAGCTACTTCAAAGG - Intronic
1026527088 7:71163379-71163401 CTCTTCTGTAGCAACCTCATAGG - Intronic
1026698687 7:72619816-72619838 GTATGCAGTAGCTACTTCAAAGG + Intronic
1027175853 7:75902897-75902919 CTCCTGAGTAGCTACGTTACAGG - Intronic
1027800255 7:82741685-82741707 CTCTTTAGTACATACTTCAAAGG - Intergenic
1027966086 7:85010458-85010480 CTCTTCAGTAGCTACTTCACTGG - Intronic
1029906733 7:104100452-104100474 TTCTTCAGTACCTAAGTCACAGG + Intergenic
1030087297 7:105827726-105827748 ATCTATAGTAGCTACTTCATAGG - Intronic
1030468527 7:109933729-109933751 GACTTCATTAGCTACTTAACAGG - Intergenic
1031309031 7:120170775-120170797 GTATTCAGAAGATACTTCACTGG + Intergenic
1034829900 7:154300020-154300042 CTCTTCAGTTGCACCTGCACAGG + Intronic
1035630841 8:1105552-1105574 CCCTTCAGTAGATAGTGCACCGG - Intergenic
1036675443 8:10828189-10828211 CTCTTCTGCAGCCACTTCCCAGG + Intronic
1037279837 8:17227103-17227125 TTCATCAGCAGGTACTTCACAGG - Intergenic
1038983880 8:32788158-32788180 CTCTTCATAAGCTACTCCAAAGG + Intergenic
1040580433 8:48694434-48694456 CTCTGCAGTGTCTATTTCACGGG + Intergenic
1040580637 8:48696107-48696129 CTCTGCAGCAGCTCCTTCAAAGG - Intergenic
1041909663 8:63075385-63075407 CACAACAGTAGCTACTTCTCAGG - Intronic
1042349797 8:67765618-67765640 CTCTTCAGTCCTGACTTCACGGG + Intergenic
1042510407 8:69605224-69605246 CTCTTCAGTGACTAGTTAACAGG - Intronic
1042714906 8:71762052-71762074 CTATTCAGCAGCTCCTTCACAGG + Intergenic
1044143083 8:88678612-88678634 CTTTTCAATAGTTACATCACAGG - Intergenic
1045280495 8:100745662-100745684 CTCTTCAGTAACTACATTAAAGG - Intergenic
1045700280 8:104858457-104858479 GTCTTCAGTACATACTTCAAAGG - Intronic
1046923008 8:119754303-119754325 CTCATTAGTAGCTACTTCACTGG - Intronic
1047783073 8:128125652-128125674 CTCTGCAATAGCTACTTCAAAGG - Intergenic
1048393509 8:133990232-133990254 CTCTTTAGTACTTACTTCACAGG - Intergenic
1054381285 9:64492828-64492850 CTCCTCAGTATCTTCTTTACTGG + Intergenic
1055808699 9:80126080-80126102 CTCTTCTGTGTCTACTTCTCAGG + Intergenic
1058108801 9:101006636-101006658 ATCTTCAGTTGCTATTTCAAGGG - Intergenic
1187586234 X:20664922-20664944 TTCCTCAGGAGATACTTCACAGG + Intergenic
1188069639 X:25703193-25703215 CTCTGGAGTAGCTGCCTCACTGG + Intergenic
1189948145 X:46201689-46201711 CTGCTCAGTACCTGCTTCACTGG - Intergenic
1190614790 X:52219103-52219125 CTTTTCAGTAGAAACTTTACAGG + Intergenic
1191701265 X:64044918-64044940 CTTTTCATTATCTTCTTCACTGG - Intergenic
1193882135 X:86936394-86936416 CACTTCCGCAGCTCCTTCACTGG - Intergenic
1194930365 X:99880655-99880677 CTCTGCAGCAGCCACTCCACTGG + Intergenic
1194939335 X:99990391-99990413 CTCTTTGTTGGCTACTTCACTGG + Intergenic
1195701352 X:107708026-107708048 CTCCTCTGTAGCCACTTCTCTGG + Intergenic
1198430606 X:136563035-136563057 CTTTTCAGTGGAAACTTCACAGG - Intergenic
1198507978 X:137319980-137320002 GGCTGCAGTAGCTTCTTCACTGG + Intergenic
1198951431 X:142076761-142076783 GCCTTCAGTACTTACTTCACAGG - Intergenic
1198996036 X:142575591-142575613 CTTTTCAGTAGAAACTTCATAGG - Intergenic
1199158363 X:144576849-144576871 CTCTTCAGTAACTATTACAGTGG - Intergenic
1201358989 Y:13126247-13126269 TTTTTCAGTAGATACTTTACAGG - Intergenic