ID: 1027966090

View in Genome Browser
Species Human (GRCh38)
Location 7:85010490-85010512
Sequence CACAGATGCCAGCCTAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027966090_1027966093 -5 Left 1027966090 7:85010490-85010512 CCTCAGTTAGGCTGGCATCTGTG 0: 1
1: 0
2: 3
3: 21
4: 137
Right 1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG No data
1027966090_1027966095 19 Left 1027966090 7:85010490-85010512 CCTCAGTTAGGCTGGCATCTGTG 0: 1
1: 0
2: 3
3: 21
4: 137
Right 1027966095 7:85010532-85010554 AAGCTTGGCCATGAGCCAGAAGG No data
1027966090_1027966094 4 Left 1027966090 7:85010490-85010512 CCTCAGTTAGGCTGGCATCTGTG 0: 1
1: 0
2: 3
3: 21
4: 137
Right 1027966094 7:85010517-85010539 TGATGAGAAGTAGGAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027966090 Original CRISPR CACAGATGCCAGCCTAACTG AGG (reversed) Intronic
904535885 1:31199079-31199101 CACAGAAGTCAGCCTGTCTGGGG + Intronic
904551641 1:31324339-31324361 CAAAGATGCCAGCCATAGTGGGG + Intronic
909036964 1:70604370-70604392 CACAGAGGCAACCCCAACTGAGG + Intergenic
916632501 1:166631423-166631445 CAGAAATGCCAGGCTCACTGGGG - Intergenic
917494699 1:175529673-175529695 CACAGATTGCAGCCTATTTGGGG + Intronic
917538732 1:175893434-175893456 CACATAGGCCAAGCTAACTGTGG + Intergenic
922671360 1:227510603-227510625 GATAGAAGCCAGCATAACTGTGG + Intergenic
922786771 1:228286801-228286823 CACAGATGCCACCATCACAGAGG + Exonic
924433960 1:244022195-244022217 CAAAGATGCCCGCCCAACAGTGG + Intergenic
1066576967 10:36836492-36836514 CTAAGATGCCAGCCTAACCTAGG + Intergenic
1067700254 10:48566587-48566609 CACAGGTGGCAGCGTTACTGCGG - Intronic
1068078926 10:52293951-52293973 CACAGCTGCCAGCAAACCTGAGG + Exonic
1069453061 10:68532654-68532676 CAAAGAGGCCAGCATGACTGAGG - Intergenic
1071454764 10:85837374-85837396 CAGGGGTGCCAGCCTCACTGTGG - Intronic
1072623462 10:97096065-97096087 GACAGCTGCCAGCCTCACTCAGG - Intronic
1074163557 10:110855138-110855160 CACAGATGCCACACCCACTGTGG - Intergenic
1075554940 10:123423583-123423605 CACAGAGGCATGCCTAACTTGGG - Intergenic
1076671311 10:132122357-132122379 CCCAGACACCAGCCTGACTGTGG + Intronic
1076884452 10:133255382-133255404 AACTGAGGCCAGCCTAACTGGGG - Intergenic
1077210406 11:1368520-1368542 CACAGAGGCCAGCCTGGCTGGGG - Intergenic
1079081527 11:17416679-17416701 AACAGATGCCAGTATATCTGTGG - Intronic
1082282600 11:50286373-50286395 CAGAGATGCCAGCCTGGGTGGGG + Intergenic
1083270816 11:61571688-61571710 CAAAGATGCCAGCCAACCTGGGG + Intronic
1084958209 11:72702649-72702671 CACAGCTGCCAGCCATCCTGAGG + Intronic
1085810270 11:79673723-79673745 CAAAGATGCCAGCCCAACGCTGG + Intergenic
1090038982 11:123273821-123273843 CCCAGATTCCAGCCTAAGTGGGG + Intergenic
1090047010 11:123344470-123344492 CACAGATGCCTTCCTGAATGAGG - Intergenic
1090275093 11:125413437-125413459 CACAGCTCCCAGCCTACCTGTGG + Intronic
1091846308 12:3658603-3658625 CACAGATGTCATTCAAACTGAGG - Intronic
1095265908 12:40157467-40157489 CCAAGATGACAGCCTCACTGAGG + Intergenic
1096463858 12:51837471-51837493 CAAAGATGGCTGCCTGACTGAGG - Intergenic
1101220056 12:102629522-102629544 GACAGAAGCCAGCTTAACTCAGG - Intergenic
1103539455 12:121655740-121655762 CACAGCGCCCAGCCTAAGTGTGG - Intronic
1105443446 13:20433981-20434003 CACAGATCCCAGCCTCACCCTGG + Intronic
1108200971 13:48042613-48042635 CACACAGGCCAACCTAACTATGG - Intronic
1108446594 13:50515080-50515102 CAAAGATGCCAACCTAGCTGTGG - Intronic
1110612907 13:77508659-77508681 CACAGTTGCCAGACATACTGGGG - Intergenic
1111455005 13:88470259-88470281 GAGAGATGCCCACCTAACTGTGG + Intergenic
1111591649 13:90354583-90354605 CACACATGCCAGCCTCACCTAGG + Intergenic
1113649287 13:112024111-112024133 TACAGATGCAAGCCTACCTCTGG - Intergenic
1115128285 14:30022919-30022941 CACAGGTGGCAGCAGAACTGAGG + Intronic
1116086627 14:40247440-40247462 CATAGTGGCCACCCTAACTGGGG - Intergenic
1116432900 14:44866934-44866956 CACAGATGCCAGCCTGATGCTGG + Intergenic
1121158621 14:91712552-91712574 CAAACATGGCAGGCTAACTGAGG + Intronic
1121409215 14:93737750-93737772 CTCAGAGGCCAGCCTGGCTGGGG - Intronic
1121559188 14:94861989-94862011 CACAGATGCCAGCCTGTTAGTGG - Intergenic
1122577025 14:102749201-102749223 CCCAGCTGCCAGCAGAACTGGGG + Intergenic
1124214736 15:27797044-27797066 CACAGAACACAGCCTCACTGGGG + Intronic
1124774818 15:32578659-32578681 CACACATGCCAGCATGACAGAGG - Intergenic
1126500123 15:49336189-49336211 GGCAGAAGCCAGGCTAACTGAGG - Intronic
1127601694 15:60543969-60543991 CCAAGATGCCAGCCTCACTGTGG - Intronic
1127861086 15:62994762-62994784 GGCAGGCGCCAGCCTAACTGGGG + Intergenic
1129192060 15:73943014-73943036 CCCAGAACCCAGCCTAGCTGTGG + Intronic
1129639588 15:77361534-77361556 AACAGCTGCCATCCTAATTGGGG - Intronic
1130368853 15:83265908-83265930 CATAGATGTCAGTCTTACTGAGG - Intronic
1131829042 15:96342818-96342840 CACAGATGCCATATTAAATGAGG - Intergenic
1132009881 15:98266600-98266622 CACAGATGACAGCCAAGATGAGG - Intergenic
1132517246 16:371501-371523 CCCTGATGCCAGCCTGCCTGGGG - Exonic
1132732552 16:1370051-1370073 CCCAGATGCCGTCCTGACTGAGG - Intronic
1133056608 16:3148502-3148524 CAGAGATGCCAGCCCAGCTGTGG + Intronic
1139388369 16:66589048-66589070 CCCATATGCCAGCCTGACTCAGG - Intergenic
1139572753 16:67823569-67823591 CACAGCTGCCAACCTTAGTGGGG - Intronic
1141143233 16:81511006-81511028 CACAGCTGCCAGCCTAACTTTGG + Intronic
1141388426 16:83644590-83644612 TACAGAAACCAGCGTAACTGAGG - Intronic
1142373390 16:89695129-89695151 CCCAGAGCCCAGCCTCACTGCGG + Intronic
1143461735 17:7108532-7108554 CACAGCTGCAAGCCGAGCTGCGG - Exonic
1147569313 17:41558332-41558354 GCCAGATGCCAGCATACCTGGGG + Intergenic
1151819807 17:76491331-76491353 CACAGATGCCAGCCATGCAGCGG - Intronic
1157441135 18:47712540-47712562 CCCAGATGACAGCCTGGCTGGGG + Intergenic
1161432146 19:4238860-4238882 CCCAGATGTCAGCCTCATTGAGG + Intergenic
1162192378 19:8957093-8957115 CACAGATGCCAGCATATCTGTGG + Exonic
1163723004 19:18907137-18907159 CACAGAGGCCACCCCAGCTGTGG - Intronic
1167611269 19:50508749-50508771 CACAAGTGCCAGCCTAAGGGTGG - Intronic
925852787 2:8099106-8099128 CACAGATGCCTGGCTGTCTGTGG - Intergenic
926382101 2:12301224-12301246 CTCAGATGCCGGCCTTGCTGAGG + Intergenic
927696389 2:25242345-25242367 CAGAAATGCTAGCCGAACTGAGG + Intronic
930025431 2:47026466-47026488 CACAGAAGCCAGGCAGACTGGGG + Intronic
933967735 2:87443582-87443604 AACAGGGGCCAGCCTGACTGAGG - Intergenic
936326064 2:111506914-111506936 AACAGGGGCCAGCCTGACTGAGG + Intergenic
938296895 2:130184161-130184183 CCCAGATGCCAGCCCGACTGTGG - Intronic
938459866 2:131490496-131490518 CCCGGATGCCAGCCCGACTGTGG + Intronic
941844775 2:170121919-170121941 CTCACAGGCCAGCCTACCTGGGG + Intergenic
946081141 2:217119545-217119567 CACAGAAGCCAGGCTGGCTGTGG - Intergenic
946089674 2:217209726-217209748 GACAAATTCCAACCTAACTGTGG + Intergenic
946853532 2:223930754-223930776 CACAGGGGCCAGCCTACCAGAGG + Intronic
1169528990 20:6464098-6464120 CAAAGATGCTAGCCTAACTTAGG + Intergenic
1169767695 20:9166059-9166081 AAAAGATGCCAGCCCAACTGGGG + Intronic
1172345797 20:34197819-34197841 CGCAGATGCAAGCCTGACTCTGG - Intronic
1173558574 20:43985351-43985373 CACAGCTTCCAGCCTCATTGCGG - Intronic
1173869282 20:46331522-46331544 CACAGCTGCCTCCCTGACTGTGG - Intergenic
1174107779 20:48175160-48175182 CCAAGAAGCCAGCATAACTGGGG + Intergenic
1175116227 20:56684483-56684505 TAGAGATTCCAGCCTAACTGTGG + Intergenic
1178275582 21:31233877-31233899 AACAGATGGCAGCCTGCCTGAGG + Intronic
1181182708 22:21078843-21078865 CCCAGATGCCAGCCCAACTGTGG + Intergenic
1181317776 22:21982125-21982147 CTGAGAGGCCAGCCTAACTTGGG - Intronic
1183656082 22:39185513-39185535 CACAGATGCCAACCCATCTGGGG + Intergenic
1185009991 22:48307473-48307495 CAGAGAGGCCAGCCTTCCTGTGG + Intergenic
1185208463 22:49553558-49553580 CACAGGTCCCGGCCTAACTCGGG + Intronic
952705410 3:36372467-36372489 CACTGAGCCCAGCCTACCTGTGG + Intergenic
954214944 3:49119503-49119525 CACAGGTGAAAGCCTCACTGAGG + Intronic
954875311 3:53799420-53799442 CACAGCTGCCTTCCTCACTGTGG - Intronic
960597601 3:119420489-119420511 CACAGTAGCCAGCCAATCTGTGG - Exonic
961946150 3:130691017-130691039 CACAGCTGCCAGGGTAGCTGAGG - Intronic
967062831 3:185887547-185887569 CACAGATGTCAGCCTAAAACTGG + Intergenic
967148767 3:186628927-186628949 CACACAGGCCAACCTAACTATGG - Intergenic
969439653 4:7209505-7209527 CACAGAAGCCAGCCTCACGCTGG - Intronic
969446678 4:7248817-7248839 CACAGAAGCCAGCCTTTCTCAGG - Intronic
973540744 4:51932837-51932859 CACAGGTGCCAGGCTGTCTGGGG + Intergenic
975834225 4:78404688-78404710 CACAGATGCAAGAGTAACTGAGG - Intronic
977650774 4:99466675-99466697 CACAGTGGCCAGCCTAAATGTGG - Intergenic
978373775 4:108054035-108054057 CACAAATGCTGGCATAACTGTGG - Intronic
978672874 4:111272281-111272303 CACAGTTACCAGGCTCACTGGGG + Intergenic
979497374 4:121398381-121398403 CACAGATGCCAGAATTTCTGGGG + Intergenic
981827435 4:148959638-148959660 GATAGAATCCAGCCTAACTGAGG - Intergenic
983461451 4:168029444-168029466 CACAGATGACAGGCTTGCTGGGG - Intergenic
985992164 5:3572208-3572230 CACATTTTCCTGCCTAACTGAGG - Intergenic
986769178 5:10956338-10956360 CACTGAATCCAGCCTAACTGTGG - Intergenic
988323840 5:29737196-29737218 CACAGATGCTAGGCTGAATGGGG + Intergenic
988905994 5:35789629-35789651 CAGAGATGCCAGCCAAAATGTGG + Intronic
995949036 5:117687171-117687193 CACAGATGCCAGAAAAATTGAGG - Intergenic
997846584 5:137291808-137291830 CACAGTGGCCAGCCTGGCTGGGG - Intronic
1001703346 5:173723158-173723180 CCTAGATGCCAGCCTCACTTTGG - Intergenic
1004843709 6:19615020-19615042 CACAGAGGCCACCCCACCTGTGG - Intergenic
1005544834 6:26855400-26855422 AACAGATGCCAGCAAAGCTGTGG + Intergenic
1006424252 6:33954420-33954442 CACTGCTGCCATCCTAGCTGGGG + Intergenic
1006834764 6:36991187-36991209 CCCTGATGCCAGCCTCACTCTGG + Intergenic
1007256787 6:40535332-40535354 CACAGCTGCCTGCCTAACTCAGG - Intronic
1008432634 6:51436977-51436999 CATATATGCCAGCCTATCTAGGG + Intergenic
1009015623 6:57897023-57897045 AACAGATGCCAGCAAAGCTGTGG + Intergenic
1017405925 6:154118153-154118175 CACATATGCCAGCTTTACAGTGG + Intronic
1022800287 7:33770190-33770212 CAGAAAAGCCAGCCAAACTGGGG - Intergenic
1023055159 7:36285027-36285049 CTCAGATGCCAGAGTTACTGGGG - Intronic
1025022261 7:55488996-55489018 CTCAGATCCCAGACTATCTGTGG - Intronic
1027966090 7:85010490-85010512 CACAGATGCCAGCCTAACTGAGG - Intronic
1030658094 7:112190509-112190531 CAGAGATGCCAGGCTACTTGAGG - Intronic
1032465312 7:132140717-132140739 CACAGACGCCTGCCTCTCTGTGG - Exonic
1033270766 7:139930852-139930874 CACAGCTGCCACCCTGGCTGAGG - Intronic
1033735830 7:144220765-144220787 CACACATGCTAGTCTACCTGTGG + Intergenic
1033747221 7:144330188-144330210 CACACATGCTAGTCTACCTGTGG - Intergenic
1036034575 8:5005040-5005062 CACAAATGCCAGCAGAACTCAGG + Intergenic
1036483877 8:9162422-9162444 CACTGATGGCTGCGTAACTGTGG + Intronic
1037103248 8:15073931-15073953 CACATAGGCCAACCTAACTATGG + Intronic
1037980154 8:23247243-23247265 CAGAGAAGCCAGCCTAACAGAGG + Intronic
1039858571 8:41437155-41437177 CACAGAGGCCAGCCTGGCTGTGG - Intergenic
1042281988 8:67064788-67064810 CACCGATGCCGGCCTCACGGCGG - Intronic
1046725688 8:117671268-117671290 CATAGATGCCTGGCTAACTGAGG - Intergenic
1046970551 8:120218596-120218618 CACTGCTCCCAGCCTAACTTAGG + Intronic
1052820682 9:33135866-33135888 CTCTGATTCTAGCCTAACTGGGG + Intronic
1052971975 9:34382101-34382123 CACAGAGGCCAGACTATATGGGG + Intronic
1053559320 9:39173739-39173761 CAGAGATACCAGCTTAATTGTGG + Intronic
1053823434 9:41993979-41994001 CAGAGACACCAGCTTAACTGTGG + Intronic
1054137791 9:61445207-61445229 CAGAGATACCAGCTTAATTGTGG - Intergenic
1054607139 9:67193386-67193408 CAGAGACACCAGCTTAACTGTGG - Intergenic
1057078489 9:92154205-92154227 CACAGATGCCAGCCCTGATGGGG - Intergenic
1059893445 9:118832347-118832369 CACCGAGGCCAGCCTGGCTGTGG + Intergenic
1060505976 9:124198740-124198762 CTCAGAGGCCAGCCCAGCTGAGG - Intergenic
1060622311 9:125078625-125078647 CACTGTGGCCAGCCTAACAGTGG - Intronic
1189213151 X:39301498-39301520 CACAAAAGCCAGCCTTTCTGGGG + Intergenic
1192320915 X:70089947-70089969 CACAGATGTCAGCCTCAGTCAGG + Intergenic
1194724601 X:97379861-97379883 CCCAGATGCCAGCCTCATTCAGG - Intronic
1197483031 X:127010804-127010826 CACAGATGCCCGCCCATCAGTGG + Intergenic
1199470113 X:148185816-148185838 CACAGGTGCCAGCCAAACATAGG + Intergenic