ID: 1027966093

View in Genome Browser
Species Human (GRCh38)
Location 7:85010508-85010530
Sequence CTGTGGGTATGATGAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027966086_1027966093 27 Left 1027966086 7:85010458-85010480 CCAGTGAAGTAGCTACTGAAGAG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG No data
1027966090_1027966093 -5 Left 1027966090 7:85010490-85010512 CCTCAGTTAGGCTGGCATCTGTG 0: 1
1: 0
2: 3
3: 21
4: 137
Right 1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027966093 Original CRISPR CTGTGGGTATGATGAGAAGT AGG Intronic
No off target data available for this crispr