ID: 1027967144

View in Genome Browser
Species Human (GRCh38)
Location 7:85026486-85026508
Sequence TCTTCCCATTTGTGTACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027967144 Original CRISPR TCTTCCCATTTGTGTACCTG AGG (reversed) Intronic