ID: 1027967144

View in Genome Browser
Species Human (GRCh38)
Location 7:85026486-85026508
Sequence TCTTCCCATTTGTGTACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027967144 Original CRISPR TCTTCCCATTTGTGTACCTG AGG (reversed) Intronic
900503614 1:3018445-3018467 CTTTCCCAGTTGTGTACTTGGGG + Intergenic
900644959 1:3704819-3704841 ACCTCCCATGTGTGTAGCTGAGG + Intronic
906408615 1:45561769-45561791 TCTTCCCATCTGTGTTTCAGGGG + Exonic
906715530 1:47965662-47965684 TCTTCCCACTTCAGTACATGGGG + Intronic
907441492 1:54481286-54481308 TATCCCCATTTTTGTACCTGAGG - Intergenic
908533563 1:65056525-65056547 TCTTCCCCATTGTGTCCCAGTGG + Intergenic
909976045 1:82047265-82047287 ACTTCCCATCTGTGTAGCTTGGG - Intergenic
910682543 1:89882252-89882274 TATTCACCTTTGTGTTCCTGGGG - Intronic
911683795 1:100749736-100749758 TCTCCCCATCTGTGTATCAGGGG - Intergenic
911833298 1:102582029-102582051 TTTTCCCATTTGTGGACTTCTGG - Intergenic
912158412 1:106950825-106950847 TTCTACCAGTTGTGTACCTGTGG + Intergenic
914426729 1:147584781-147584803 CCTTACCATTTGTGTACTTTAGG - Intronic
915051412 1:153078110-153078132 TCTTCCAATTTGTGTTGTTGGGG - Intergenic
915051720 1:153082324-153082346 TCTTCCAATTTGTGTTTTTGGGG - Intergenic
917170147 1:172163790-172163812 TCTTGCCATTTGTGACCATGCGG - Intronic
918070204 1:181128868-181128890 TGTCCCCTTTTGTGTGCCTGCGG + Intergenic
919022096 1:192119301-192119323 TCTTCCCATTTGTGAATGGGAGG - Intergenic
919492613 1:198224791-198224813 TCTCCACATTTCTTTACCTGAGG - Intronic
920952440 1:210585185-210585207 CCTTCCCAGCTGTGTACCTTGGG + Intronic
921926205 1:220711806-220711828 TCTTCCCATTTGAGGGTCTGTGG + Intergenic
923979165 1:239301602-239301624 TCTTCGCATATGTGTATTTGGGG - Intergenic
924752336 1:246905856-246905878 TCTTCCCAGTTCTGTCTCTGGGG - Intronic
1063181624 10:3606505-3606527 TCTTCTGATTTTTGTAACTGTGG + Intergenic
1063569025 10:7197377-7197399 TTTTTCCATTTGTGTATCTCTGG + Intronic
1064382503 10:14858953-14858975 CCTTCTCATTTTAGTACCTGGGG + Intronic
1066985663 10:42464539-42464561 TCTGCGCATTTGTGTTCATGTGG - Intergenic
1067162693 10:43840886-43840908 TCTTCCCATTTCTGTCCACGTGG + Intergenic
1068676837 10:59777665-59777687 TCTTGACTTCTGTGTACCTGCGG + Intergenic
1070137332 10:73706504-73706526 TCTGCGCATTTGTGTTCATGTGG - Intergenic
1074107220 10:110397716-110397738 TCTTCCCCTTTGTATCCATGTGG + Intergenic
1075428598 10:122362427-122362449 TCCTACCATCTGTGAACCTGTGG - Intergenic
1076116611 10:127905999-127906021 CCTGCCCATTTCTGTCCCTGGGG - Intergenic
1077585312 11:3447121-3447143 GCCTCCCATTCCTGTACCTGTGG - Intergenic
1078467788 11:11562932-11562954 TCTTCCGATCTGTGAACTTGAGG - Intronic
1079876733 11:25867197-25867219 TTTTCCCATTTTTGTACATGAGG - Intergenic
1081493213 11:43582533-43582555 TCTACCCATTTCTGTCCCTGTGG - Intronic
1086274774 11:85113655-85113677 TGTTCCCATTGATCTACCTGTGG + Intronic
1086839027 11:91661550-91661572 TTTTCCCTTCTGTGTACCAGTGG - Intergenic
1094090002 12:26638783-26638805 TCTTCCTATTTGTGTAGTTTTGG - Intronic
1094107581 12:26830926-26830948 TATTCCCATTTGTAGAACTGAGG + Intronic
1095746120 12:45660809-45660831 TCTTACCATTTGTTTTCCAGAGG + Intergenic
1095858497 12:46888565-46888587 TCTTCCCATTGGGGGAACTGGGG + Intergenic
1096864178 12:54551558-54551580 TTCTCCCATTTATGGACCTGGGG - Intronic
1097495293 12:60324055-60324077 TCTTTCCATTTATGTAAATGAGG - Intergenic
1102620359 12:114189768-114189790 TCTTCTCATTTGTGTGACTTTGG - Intergenic
1104425774 12:128677035-128677057 TCTTCCTATTATTGTTCCTGGGG - Intronic
1105204182 13:18206338-18206360 TCTTCCCTTTTGTGAAACTTTGG + Intergenic
1107315160 13:39123174-39123196 TCTTCCCTTATGTGCTCCTGGGG - Intergenic
1108294554 13:49000690-49000712 TCTTTCACTTTGTGAACCTGGGG + Intronic
1110950438 13:81482448-81482470 ACTTCACTTTTGTGTACTTGGGG + Intergenic
1111539998 13:89657277-89657299 TCTTCTCCTTTATGAACCTGGGG + Intergenic
1112989524 13:105495137-105495159 TCTTCTCATTTGGGGACCTGTGG + Intergenic
1113374687 13:109753467-109753489 TCTTAGCATTTTTGTACCTCGGG + Exonic
1115383120 14:32762600-32762622 TCTTGGCTTTTGTGTAGCTGAGG - Intronic
1116080916 14:40170632-40170654 TTCTTCCATTTTTGTACCTGTGG - Intergenic
1116616636 14:47148784-47148806 TTGTCCAATTTCTGTACCTGAGG - Intronic
1117397957 14:55329976-55329998 TCTTCCCAAATGAGGACCTGTGG + Intronic
1117527359 14:56622650-56622672 TCTTCCCTTTTATGTATCTATGG - Intronic
1118049220 14:62008204-62008226 TCTTCCCATATCTGCCCCTGAGG + Intronic
1118295656 14:64566573-64566595 ACTTCCCAATTTTGTAGCTGAGG - Intronic
1118674440 14:68168141-68168163 TCTTCCTATCTGAGTATCTGTGG - Intronic
1120622822 14:86786757-86786779 TCTTATTATTTGTGTACCTATGG + Intergenic
1121019674 14:90571978-90572000 TTTTCCAGTTTGTGTCCCTGTGG - Intronic
1122069247 14:99195017-99195039 TTTTCCCATCTGTGCACCTGGGG - Intronic
1125930522 15:43596402-43596424 TCTTCTCATTGTTGTGCCTGAGG - Exonic
1125943690 15:43696234-43696256 TCTTCTCATTGTTGTGCCTGAGG - Exonic
1129234108 15:74213652-74213674 TTTTCCCATTTGTGTGACGGAGG + Intergenic
1131249050 15:90819038-90819060 TCTTCCCAGTGGTGACCCTGTGG - Intergenic
1132092663 15:98958422-98958444 CCTTCCCATCTGTGTCCTTGGGG - Exonic
1133042236 16:3066860-3066882 TCCTCCCGTGTGTGTACATGGGG + Intronic
1133612033 16:7442336-7442358 TCTTCTCCTTTGTGTGCCTAAGG - Intronic
1134765528 16:16754332-16754354 TCTCCCCATTTGACTACCTGTGG + Intergenic
1134980520 16:18604880-18604902 TCTCCCCATTTGACTACCTGTGG - Intergenic
1136395729 16:29991548-29991570 TCTTCCCACTTCTATTCCTGAGG + Intronic
1138464197 16:57175357-57175379 TCTTTCCTTTTGAGTAACTGTGG + Intronic
1139167989 16:64593080-64593102 TGTTCTGATTTTTGTACCTGGGG + Intergenic
1139258382 16:65565625-65565647 TTTTTCCATTTGTGTACATATGG + Intergenic
1139320951 16:66113494-66113516 TCCTCCCATTGGTGAAGCTGTGG + Intergenic
1140329866 16:74045168-74045190 TTTTCCTATTTTTGTAGCTGTGG - Intergenic
1144198637 17:12919280-12919302 TTTTCCCTTTTGTGTTACTGAGG - Intronic
1148321405 17:46757152-46757174 TCTTGCCATTTGTATACTTTTGG + Exonic
1148652329 17:49259228-49259250 TGTTCCAATTTGTGTACCTTGGG - Intergenic
1149594433 17:57855849-57855871 TCTCCCTATCTGTGTATCTGGGG - Intergenic
1152069279 17:78127035-78127057 CCTCACCATTTATGTACCTGGGG - Intronic
1152997097 18:417935-417957 GCCTCCCATTTTTGTCCCTGAGG + Intronic
1153923618 18:9813173-9813195 TCTTGTCATTTGTGGACCTTAGG + Intronic
1155074548 18:22343185-22343207 TCTTCCCATCTGTGCGCCCGAGG + Intergenic
1155776288 18:29766222-29766244 TCTCCTCATCTGTGGACCTGTGG + Intergenic
1155933798 18:31733899-31733921 TCTTCCAATTCATGTACATGGGG - Intergenic
1156140532 18:34103899-34103921 TTTTCCCATCTGTGCAACTGTGG + Intronic
1156896973 18:42257042-42257064 TCTGCCAATTTGAGTGCCTGTGG + Intergenic
1157301822 18:46484915-46484937 TAGGCCCATTTGTGTACCTATGG + Intronic
1158223361 18:55172637-55172659 TTTTCACATTTGTGTAGCTTGGG - Intergenic
1164384776 19:27763312-27763334 TTCTCCCATTTGTGTGCCTGGGG + Intergenic
1164385979 19:27770925-27770947 CCTTCCCATTTGAATGCCTGGGG + Intergenic
1164553890 19:29234928-29234950 GCTGCCCAGTTGTGCACCTGAGG + Intergenic
1165966165 19:39582760-39582782 TCTTCCCATGTGTGTCAATGTGG + Intergenic
1165971822 19:39638234-39638256 TCTTCCCATGTGTGTCAGTGTGG + Intergenic
1165977794 19:39692404-39692426 TCTTCCCATGTGTGTCAATGTGG + Intergenic
1166801315 19:45459136-45459158 TCTACCCATTTGTGTGTGTGTGG + Intronic
1167002176 19:46752246-46752268 TCTTCCCGCTTCTGTTCCTGTGG - Intronic
1168294328 19:55371244-55371266 TCTCCCCTTTTCTGTCCCTGGGG - Intergenic
926258905 2:11238311-11238333 TCTTCCAATCCGTGTACATGAGG - Intronic
926279505 2:11434010-11434032 TCTTCCCTTTTCTATGCCTGGGG + Intergenic
926459387 2:13110078-13110100 TCTTCCCATAGGGCTACCTGGGG + Intergenic
927081076 2:19631110-19631132 CCTTCCCATTTCTCTACATGGGG - Intergenic
929957272 2:46467703-46467725 TCTTCCTAGCTGTGTAACTGTGG + Intronic
930251312 2:49037107-49037129 TCTTCCCATTAGAGAAACTGGGG + Intronic
931855243 2:66296087-66296109 TCTTCTCATTTATGCATCTGTGG - Intergenic
934608711 2:95718611-95718633 TCTTCCTATTTGTGCATGTGTGG + Intergenic
937382059 2:121387307-121387329 TCTACCCATTTATTTACATGTGG - Intronic
937563426 2:123254221-123254243 TATTCCCATTTTTGGAACTGAGG - Intergenic
937764577 2:125644878-125644900 TCTTTCCATTTGTTTTCCTGTGG + Intergenic
938677598 2:133654476-133654498 TCTTCCCATTTCTGGATCAGGGG + Intergenic
938948402 2:136235157-136235179 TCTTCCCATATGTGGAAATGTGG + Intergenic
941374782 2:164714213-164714235 TTTTTCCATTTGTCTTCCTGAGG + Intronic
942517926 2:176773136-176773158 TCTTGACTTCTGTGTACCTGCGG - Intergenic
1169948163 20:11011579-11011601 TTCTCCCAGTTGTTTACCTGGGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1173942153 20:46920723-46920745 TTTTTGCATTTGTGTCCCTGGGG - Intronic
1176713794 21:10331744-10331766 TCTTCCCTTTTGTGAAACTTTGG - Intergenic
1176726837 21:10443188-10443210 TTTTGCCATTTGTGTATCTTTGG + Intergenic
1177236125 21:18391877-18391899 TCTTGACTTCTGTGTACCTGCGG + Intronic
1178068953 21:28939950-28939972 TCTTTGCATTTGTATATCTGTGG - Intronic
1179279327 21:39921014-39921036 CCTTTCCATTTGTTTTCCTGGGG + Intronic
1180287554 22:10763892-10763914 TTTTGCCATTTGTGTATCTTTGG - Intergenic
1184052090 22:42014648-42014670 TTTTCCCATTTGTGTTACTCAGG + Intronic
1185379990 22:50503850-50503872 TCTTCCCATCCGTGTCCCTGGGG - Exonic
952117190 3:30196903-30196925 TCTTCCCTCTTGTGCACCTGGGG - Intergenic
954994794 3:54871665-54871687 TGTACCCACTTCTGTACCTGGGG + Intronic
955922266 3:63969879-63969901 TCTTCTCACCTGTATACCTGAGG + Intronic
956068024 3:65417715-65417737 TCTTGCCCATTGTGTGCCTGTGG - Intronic
957482366 3:80815117-80815139 TCTTCTCATTTGTCTACTTCTGG - Intergenic
959507732 3:107174815-107174837 TCTTCACTTCTGTGCACCTGCGG + Intergenic
959949123 3:112159632-112159654 TCTGCCCATTGCTGTAACTGGGG + Intronic
964892482 3:161553580-161553602 TCTTCCTCTCTGTGTCCCTGAGG - Intergenic
967289139 3:187902269-187902291 ACTTCCTAATTGTGTTCCTGTGG - Intergenic
967419768 3:189260134-189260156 TCTTCCCATTTGTAAACTGGAGG + Intronic
970513779 4:16806806-16806828 TCTTCCCAGCTGTGTCACTGAGG + Intronic
973993979 4:56437985-56438007 TCTTTCCATTTGTGTACCGTTGG + Intronic
974339524 4:60597286-60597308 TTTTTCCATTTGTGAAACTGAGG - Intergenic
975244043 4:72097794-72097816 TCTTCCCACTTGTGTATTTTGGG - Intronic
977116400 4:93034203-93034225 TCTTCCCATCTGTCTAAATGTGG - Intronic
980210818 4:129784976-129784998 TCTTCTCTTTTCTGTCCCTGAGG + Intergenic
982381070 4:154748253-154748275 TGTTCCCATTTGACTACTTGAGG + Intronic
983598014 4:169492636-169492658 TCATACCAGTTGTGTACCTGTGG + Intronic
984000787 4:174240867-174240889 GCTTCCATTTTGTGTACATGTGG + Intronic
985649686 5:1101653-1101675 TCTGCCCACTTGCTTACCTGGGG - Intronic
986794362 5:11194256-11194278 TCTTCCCATTTCTGCACCCCAGG - Intronic
988848531 5:35155310-35155332 TCTACTCATTTGTGAAGCTGAGG + Intronic
993046699 5:82874391-82874413 TCTTCCTATTTCTGTAACTGAGG - Intergenic
993532083 5:89037374-89037396 TCTTCCCTTTTGTCTAGCTTTGG + Intergenic
994687875 5:102979085-102979107 TCTTCCTATTTGTATATCTAGGG - Intronic
995035963 5:107534310-107534332 TCTTTCCTTTTGTGTATATGGGG + Intronic
997450668 5:133980470-133980492 TCAGCCACTTTGTGTACCTGTGG + Intronic
998436677 5:142116033-142116055 TCCTCCCATTTTGGTATCTGTGG + Intronic
1000028697 5:157382790-157382812 TCTTCCAATTTGTGATTCTGTGG - Intronic
1000945486 5:167417886-167417908 TCCTCCCCTTTGTGTACATTTGG + Intronic
1001959939 5:175873575-175873597 TCTTCCCCTTTGGAGACCTGTGG - Intronic
1003791514 6:9552155-9552177 TCTTGTCTTCTGTGTACCTGTGG + Intergenic
1007813159 6:44500546-44500568 TCTTTACTTTTGTGTACATGGGG - Intergenic
1008563160 6:52741651-52741673 TCTGCCCATATGTCAACCTGAGG - Intergenic
1009054149 6:58315506-58315528 TCTTTCCATTTCTGTACTTTTGG + Intergenic
1009236979 6:61135056-61135078 TCTTTCCATTTCTGTACTTTTGG - Intergenic
1009685777 6:66955031-66955053 TCTTCCCATATGTCTACCATTGG - Intergenic
1010662680 6:78588546-78588568 TTTTTCCATTTGTGTAAGTGGGG - Intergenic
1011602543 6:89073150-89073172 GCTTCTCATTTGTGCAACTGTGG - Intergenic
1013176271 6:107679968-107679990 TGTGCCCATTTTTGTAGCTGAGG - Intergenic
1013224990 6:108114298-108114320 TCTTCCCATTTATGTCCCTCTGG + Intronic
1015302841 6:131673941-131673963 TCTTCTGATTTTGGTACCTGAGG + Intronic
1015847537 6:137536539-137536561 TCTACCCATTTGCGTGTCTGTGG + Intergenic
1016212736 6:141559960-141559982 TCCTCTTATGTGTGTACCTGTGG - Intergenic
1016387502 6:143542700-143542722 TCTTGCCTTGTGTTTACCTGGGG + Intronic
1018347005 6:162910040-162910062 ACTTACCAGTTGTGTAACTGTGG + Intronic
1018863047 6:167725841-167725863 TTTTCCCACCTGTGAACCTGAGG - Intergenic
1019358636 7:593850-593872 GCTTCTCATTTATGCACCTGTGG - Intronic
1019945031 7:4321156-4321178 TTTTCCCATTTATGTATCTTTGG + Intergenic
1020472295 7:8552495-8552517 TTTTGCCATTTATGTACCCGGGG - Intronic
1024818436 7:53298064-53298086 TCTTCCCCTCTCTGCACCTGAGG - Intergenic
1027967144 7:85026486-85026508 TCTTCCCATTTGTGTACCTGAGG - Intronic
1028847586 7:95499616-95499638 TTTTACCAATTGTTTACCTGTGG - Intronic
1029896751 7:103990767-103990789 TCTACTCATTTCTGTACGTGCGG - Intergenic
1030240086 7:107313016-107313038 TCTTCCCATTTGTGAGGCTTAGG + Intronic
1030595432 7:111532592-111532614 TCTTTCCATTTTTGTCCCTTGGG - Intronic
1031083704 7:117282106-117282128 TTTTCCCATTTTTGTACTTTAGG - Intronic
1032061653 7:128730064-128730086 TCCTCCCATTGCTGTACCTATGG - Exonic
1033043757 7:137941964-137941986 TTTTCCCATTTGCTTACCAGGGG + Intronic
1033375371 7:140756398-140756420 TCATCCCATTTCTCTAGCTGGGG - Intronic
1034603272 7:152284773-152284795 TTTTGCCATTTGTGTATCTTTGG - Intronic
1035778968 8:2212220-2212242 TCTTCACATTTCTTCACCTGTGG - Intergenic
1036646639 8:10615020-10615042 TCTGCCCAGATGTGCACCTGGGG - Intronic
1037817102 8:22118111-22118133 TCTACACATGTGTGTACCTGTGG + Intronic
1039576865 8:38630580-38630602 TCTTCCCACTTGAGTACCCCAGG - Intergenic
1040396036 8:47001136-47001158 ACTTCCCATTCTTGTATCTGTGG - Intergenic
1040801633 8:51348762-51348784 TCTTCCCTATTGTTAACCTGAGG + Intronic
1041835930 8:62215313-62215335 TCTTCCCTTTTGTGAAACTTTGG + Intergenic
1043919953 8:85970346-85970368 ACTTGCCATCTGTGTATCTGAGG + Intergenic
1044322843 8:90824010-90824032 TCTTTCCATTTGAGGGCCTGAGG - Intronic
1047731287 8:127730906-127730928 TCTTCCCTTTTGTGTCTCTGGGG + Intergenic
1050166660 9:2771335-2771357 TCTCTCCATTTTTGTCCCTGGGG - Intronic
1050685246 9:8161397-8161419 ACTTCTTATTTGTGTACCTTGGG - Intergenic
1050767213 9:9149891-9149913 TCTTTCCATTTAAGTACCTGAGG + Intronic
1055358388 9:75461891-75461913 TCTTCCCATGAGTGTATCTTGGG + Intergenic
1056045772 9:82714036-82714058 TCTGCCCAATTGTGTGCCTGAGG - Intergenic
1056223284 9:84470601-84470623 TCTTCCCAATTCTGTGCGTGTGG + Intergenic
1056333177 9:85538717-85538739 TCTACCCATTTGTCTTCCTATGG + Intergenic
1056399035 9:86209203-86209225 GTTTCCCATCTGGGTACCTGAGG - Intergenic
1056616832 9:88175700-88175722 TGTTCCCATTTATTTAACTGGGG - Intergenic
1057463655 9:95291605-95291627 TCTTCCAATCTGTGAACATGGGG - Intronic
1058001282 9:99868628-99868650 CCTTCCCATTTCTTTACCTCAGG + Intergenic
1058056921 9:100457960-100457982 TCTTCCCACTTGTGATTCTGTGG - Intronic
1059694945 9:116722112-116722134 TCTTCCCAGCTGTCTACCAGTGG + Intronic
1061260360 9:129477250-129477272 TCTTCTGCTTTGTGTCCCTGGGG + Intergenic
1061620026 9:131805937-131805959 TGTGCACATGTGTGTACCTGCGG + Intergenic
1194880546 X:99245693-99245715 TCTTCTCATTTATGTGTCTGAGG - Intergenic
1196644838 X:118106651-118106673 TTTTCCCTTCTGTGCACCTGTGG + Intronic
1197962071 X:132017820-132017842 TTTTGCCATATGGGTACCTGAGG - Intergenic
1198055063 X:132985706-132985728 TCTTCCTATTACAGTACCTGAGG - Intergenic
1198417137 X:136431868-136431890 TCTTCACATTTGTGTTCCCTAGG + Intergenic
1200916181 Y:8573244-8573266 GCTTCCCATGGGTGTAGCTGAGG - Intergenic