ID: 1027967406

View in Genome Browser
Species Human (GRCh38)
Location 7:85029616-85029638
Sequence ATGCCAGGGGGATTTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 6, 3: 30, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027967397_1027967406 15 Left 1027967397 7:85029578-85029600 CCAAACTGGACTAGAGTGCAGAA 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG 0: 1
1: 1
2: 6
3: 30
4: 247
1027967396_1027967406 24 Left 1027967396 7:85029569-85029591 CCATGATAACCAAACTGGACTAG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG 0: 1
1: 1
2: 6
3: 30
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027967406 Original CRISPR ATGCCAGGGGGATTTCCTGG TGG Intronic