ID: 1027972411

View in Genome Browser
Species Human (GRCh38)
Location 7:85102330-85102352
Sequence CACAGGTCACACTCCAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027972411_1027972415 -5 Left 1027972411 7:85102330-85102352 CCTACTCTGGAGTGTGACCTGTG 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1027972415 7:85102348-85102370 CTGTGTCAGGGCAAAGACCATGG No data
1027972411_1027972416 9 Left 1027972411 7:85102330-85102352 CCTACTCTGGAGTGTGACCTGTG 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1027972416 7:85102362-85102384 AGACCATGGTGTAATTATTTTGG 0: 1
1: 0
2: 1
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027972411 Original CRISPR CACAGGTCACACTCCAGAGT AGG (reversed) Intronic
901192496 1:7420947-7420969 CACAGGCCACACACCAGTGGGGG + Intronic
901223323 1:7596440-7596462 CACAGGACACACAGAAGAGTAGG - Intronic
901324241 1:8357460-8357482 CACTGGCCACCCTCCAGTGTGGG - Intronic
902943643 1:19818121-19818143 CAGAGGTCGCACTCCAGCCTGGG - Intergenic
902969980 1:20041269-20041291 CACAGGTGACACTCTGGAGGGGG - Intronic
903142311 1:21345848-21345870 CCCGGGTCACACTCCAGTGCAGG - Intergenic
904170876 1:28591690-28591712 CTCAGGTCACACAGCAGAGTTGG - Intronic
904800544 1:33089630-33089652 CAAAGGTCAAGCTCCAGAGCTGG - Intronic
907237564 1:53062476-53062498 CAGGGGTCGCACTCCAGAGGAGG - Intronic
907325381 1:53634756-53634778 CACACGTCCAACCCCAGAGTGGG + Intronic
907523713 1:55041184-55041206 AACAGGTCACACTGCAGACAGGG - Intronic
909940842 1:81610016-81610038 GAAAGGCCACACTCCAGAGGAGG - Intronic
910903345 1:92146407-92146429 CAAAGGTACCACTCCAGTGTGGG - Intronic
911418647 1:97610360-97610382 CACAGGTCACACAAGGGAGTCGG - Intronic
912919863 1:113855459-113855481 CACACTCCACACTCCAGACTGGG + Intronic
914830595 1:151168191-151168213 CAGAGGTCAAACTCCAAAGTGGG + Exonic
915446405 1:155977185-155977207 GACAGGTCCCAGCCCAGAGTTGG - Intronic
915624444 1:157106212-157106234 GACAGGCAACACTCCAGAGGAGG - Intergenic
916052595 1:161046979-161047001 CACAGGTCCCACTCTAGTGAAGG - Exonic
916418691 1:164616119-164616141 CACAGCTGCCACTCCAGAGGTGG - Intronic
921953469 1:220957790-220957812 CACAGGTCAGAATCCTGAGCAGG - Intergenic
922774564 1:228208769-228208791 CACAGGGAAGAGTCCAGAGTGGG - Intronic
1064173760 10:13056514-13056536 CACAGATCACACTCAAGCCTGGG + Intronic
1064194078 10:13231382-13231404 CAGAGGTCACACAGCAGATTGGG + Intronic
1067466547 10:46503346-46503368 CACGTGTCCCACTCCAGTGTAGG - Intergenic
1067620641 10:47881259-47881281 CACGTGTCCCACTCCAGTGTAGG + Intergenic
1067900208 10:50232126-50232148 CACAGTTCACACACCACAGTTGG - Intronic
1068867941 10:61914871-61914893 CATAGGTGAGACTCAAGAGTCGG + Intronic
1070023027 10:72605560-72605582 CACAGGGCAAACCCCACAGTTGG - Intronic
1072162656 10:92782838-92782860 TAAAGGTCACACAACAGAGTGGG - Intergenic
1073040385 10:100600173-100600195 CAGGGCTCACAGTCCAGAGTGGG - Intergenic
1073064824 10:100751849-100751871 CACAAGTCACACACCAGCCTTGG + Intronic
1077198574 11:1293729-1293751 CACAGTTCAAGCTCCAGAGCTGG - Intronic
1083609032 11:63996434-63996456 CAAAGGTCACACTCCAAAGGTGG - Intronic
1083828907 11:65218531-65218553 CACAGCTCACTCTGCAGGGTGGG + Intergenic
1086862389 11:91940038-91940060 GACAGCCCACACTGCAGAGTTGG + Intergenic
1090432144 11:126655049-126655071 CACAGGTCTCACCCCACTGTGGG + Intronic
1090917271 11:131176776-131176798 CACAAGTCACACTGCAGACTTGG + Intergenic
1091366150 11:135022350-135022372 CACAGGGCAAACCCCAAAGTTGG + Intergenic
1091680669 12:2524570-2524592 CCCAGCTCACACTCCACCGTGGG - Intronic
1095349093 12:41188495-41188517 CACAGTTTGCACTCCAGAGCCGG - Exonic
1096605911 12:52766392-52766414 GATAGGTCACACTCCAAGGTAGG - Intergenic
1096666703 12:53171069-53171091 CACAGACCACACTCTTGAGTAGG + Intronic
1097606416 12:61759933-61759955 CACAGGGCACAATGGAGAGTAGG + Intronic
1098011810 12:66061272-66061294 CAGAGGTCACATTCCAGCCTGGG + Intergenic
1098799099 12:74930794-74930816 CACAGGTCTCACTGCAGCCTCGG + Intergenic
1099734484 12:86550516-86550538 AGCAGGGCACACTCCAGAGGTGG - Intronic
1100834272 12:98551428-98551450 CAGAGGTAACACTCCAGCCTGGG + Intergenic
1101374242 12:104157138-104157160 CACTGGCCAAACTCAAGAGTAGG - Intergenic
1101496122 12:105255949-105255971 CACAGGTCTCATTCCATACTGGG - Intronic
1102224377 12:111217523-111217545 CCCAGGTCACACTTTGGAGTGGG - Intronic
1103198269 12:119065411-119065433 CACAGTTGACAGCCCAGAGTAGG + Intronic
1103669717 12:122603431-122603453 CAAAGGTCACACCCCAAAGGCGG - Intronic
1103893305 12:124255974-124255996 CCCAGGCCACACCCCAGACTTGG + Intronic
1103941179 12:124502116-124502138 CTCAGGACTCACTCCAGAGCTGG - Intronic
1104608913 12:130211977-130211999 CCCACCTCACCCTCCAGAGTAGG + Intergenic
1105254659 13:18735504-18735526 CCCAGCTCAGACTCCTGAGTAGG + Intergenic
1105468947 13:20674139-20674161 CACAGGCCACACTCCAAGGCTGG + Intronic
1105807138 13:23960063-23960085 TACAGGTCACACTCCCAAGGAGG - Intergenic
1107969187 13:45624971-45624993 GACAGGTCCCAGTCCAGAGAAGG - Intergenic
1108253572 13:48590052-48590074 AACAGGACACTCTCCAGATTTGG - Intergenic
1113471317 13:110548751-110548773 CACAGGTTGCACTCCAGGTTGGG - Intronic
1116471668 14:45292807-45292829 CCAAGATCACACTCCAGTGTGGG - Intergenic
1117594767 14:57315034-57315056 CACAGCTCAAACTCAAGGGTTGG + Intergenic
1118429229 14:65699322-65699344 GACCAGTCAGACTCCAGAGTTGG - Intronic
1118479838 14:66153345-66153367 CACAGCTCCCACACCACAGTTGG - Intergenic
1119864613 14:77962909-77962931 CAGAGGTCTCATTCCAGAGAGGG + Intergenic
1120502468 14:85313524-85313546 CACAGCTGCCTCTCCAGAGTGGG - Intergenic
1121112268 14:91320578-91320600 CACAGGTGACAATCCGGACTTGG + Intronic
1123192026 14:106580512-106580534 CACAGGGCACACTGCAGGGCTGG + Intergenic
1123220766 14:106853192-106853214 CACAGGGCACACTGCAGGGCTGG + Intergenic
1124562200 15:30784899-30784921 CAGAGGTGACACTGCAGAGCAGG - Intergenic
1125587174 15:40829017-40829039 CTCAGGTCCCATTCCAGAGCTGG - Intergenic
1129174918 15:73832913-73832935 CACAGGTCCCAATCCACAGCTGG + Intergenic
1129845495 15:78766081-78766103 CCCAGGCCACCCTCCAGAGCTGG + Exonic
1131581000 15:93643314-93643336 CAGATGTCACTCTCCAGAGCAGG + Intergenic
1132062464 15:98703676-98703698 CAGAGGCCACACTACAGAGCTGG - Intronic
1132115210 15:99131046-99131068 CCCAGGTCCCCCTCCAGAGAGGG - Exonic
1133740122 16:8644984-8645006 GACAGTTCAGACTCCAGAGGAGG + Intronic
1134800710 16:17081984-17082006 CACAGGTCAAACCCCAAAATTGG + Intergenic
1136598309 16:31266721-31266743 TCCAGGTCACACTGCAGAGGAGG + Intronic
1136872732 16:33823506-33823528 CACAGGACAGATGCCAGAGTGGG + Intergenic
1137530389 16:49275605-49275627 GAGAGGCCACACTCCAAAGTGGG + Intergenic
1141348681 16:83272990-83273012 CACCAGTCACACTGCAGATTGGG - Intronic
1141771667 16:86093339-86093361 CACAGGACAGACGCCAGAGGTGG + Intergenic
1203099441 16_KI270728v1_random:1292548-1292570 CACAGGACAGATGCCAGAGTGGG - Intergenic
1143147801 17:4787981-4788003 CAGAGGTCACATTCCAGTGGGGG + Intergenic
1145024947 17:19461316-19461338 CACAGGGCACACTTCAGGCTGGG - Intergenic
1145210645 17:21010825-21010847 CTCAGCTCACACTCCGGGGTAGG + Intronic
1145888363 17:28397929-28397951 CAAAGGTCTCACTCCAGGTTTGG + Exonic
1146305184 17:31725008-31725030 CCCAGGTCTCATTCCACAGTTGG + Intergenic
1146480574 17:33201918-33201940 CCCAGCTCAGACTCCTGAGTAGG - Intronic
1153475190 18:5491304-5491326 CTTACGTCACAGTCCAGAGTAGG - Intronic
1154436369 18:14345110-14345132 CCCAGCTCAGACTCCTGAGTAGG - Intergenic
1158495637 18:57952865-57952887 CACAGGTTAAAATCTAGAGTGGG + Intergenic
1159889715 18:73942244-73942266 CACAGGTCACATCCCACGGTGGG + Intergenic
1160923208 19:1530122-1530144 CACAGGCCACACTCCAAAGGGGG + Intronic
1163043494 19:14620959-14620981 CATAGGTCACAGTCAACAGTTGG + Intronic
1163667360 19:18609678-18609700 CAGAAGTCACACTCCAGGGTGGG - Intronic
1165636742 19:37346792-37346814 CCAAGGTCACAATCCAAAGTAGG + Intronic
1165755647 19:38291239-38291261 CACAGGTCACACTCCTTAGCCGG + Intronic
1166011343 19:39944953-39944975 CACAGGTCATACTCAAGACATGG - Intergenic
1166246267 19:41529179-41529201 CACAACTCACTCTCCAGAATGGG + Intergenic
1166557231 19:43708608-43708630 CCCAGATCACACTCCAGTCTGGG + Intergenic
1168193070 19:54754393-54754415 GAGAGATCAAACTCCAGAGTTGG + Intronic
1168197406 19:54785667-54785689 CAGAGAGCAAACTCCAGAGTTGG + Intronic
1168327224 19:55544621-55544643 CACAGGCCCCACCCCAGAGAGGG - Intronic
925444802 2:3918689-3918711 TGCAGCTCACACTCCAGAGGGGG - Intergenic
926594940 2:14779749-14779771 CTCAGGTCACAGCCCAGAATTGG - Intergenic
926990609 2:18676244-18676266 CACCAGTCACACTCCTGAATTGG + Intergenic
930846255 2:55907750-55907772 CACAGAACACAATCCAAAGTGGG - Intronic
932271085 2:70411021-70411043 CACAAGTCACCCTCCAGAGTGGG - Intergenic
932577788 2:72972277-72972299 CTGAGGTCACACAGCAGAGTGGG + Intronic
934489624 2:94752366-94752388 CCCAGCTCAGACTCCTGAGTAGG + Intergenic
935720734 2:105976741-105976763 CACAAGTCAGACTGCAGAGTTGG + Intergenic
936580747 2:113698528-113698550 CACATGTCTCACTCATGAGTGGG + Intergenic
937992880 2:127674166-127674188 CACAGGTCACTCTCCGGGCTGGG + Intronic
938070532 2:128305949-128305971 GGCAGGTCACTCCCCAGAGTGGG - Intronic
941131639 2:161658348-161658370 AATAGGTTCCACTCCAGAGTAGG + Intronic
942699634 2:178690404-178690426 CTCAGGAAACACTCTAGAGTAGG + Intronic
945290167 2:208118929-208118951 CAAAGGTCACACTCAAGAATGGG + Intergenic
947200055 2:227607147-227607169 CCCAGATCACACTCCAGCCTGGG - Intergenic
947348481 2:229218747-229218769 CACAGGCCAGACTGCAGAGTGGG + Intronic
948053486 2:234995102-234995124 CGCTGGCCACTCTCCAGAGTTGG + Intronic
948226675 2:236316721-236316743 GATACGACACACTCCAGAGTGGG + Intergenic
948283653 2:236768129-236768151 CATAGGTCAACCTCAAGAGTTGG - Intergenic
1168916401 20:1491642-1491664 CATAGGACGCACTCCAGAATCGG + Intergenic
1168960637 20:1866999-1867021 CTCAGGTCACAGTCCAGTGTAGG - Intergenic
1170964241 20:21052313-21052335 CACTGGTCACTCTCATGAGTGGG + Intergenic
1172328309 20:34054773-34054795 CTGAGGTCACACTCCAGCCTGGG + Intronic
1174295739 20:49543802-49543824 CACAGCTGACACTCCAGTGGGGG - Intronic
1175885982 20:62291190-62291212 CCCAGGTCACACTCGTGAGCTGG - Intronic
1176840672 21:13840540-13840562 CCCAGCTCAGACTCCTGAGTAGG + Intergenic
1177039181 21:16085162-16085184 CTCAGGACACAGGCCAGAGTCGG - Intergenic
1177769457 21:25498256-25498278 TCCAGGTCATACTCCAGAGCTGG - Intergenic
1179178428 21:39025475-39025497 CACACATCACACTCGAGAGCAGG + Intergenic
1181314243 22:21961519-21961541 CAGAGCCCACACTCCACAGTGGG + Intronic
1183435259 22:37790431-37790453 CTCAGGTCACACAGCAGATTTGG + Intergenic
1183510520 22:38231918-38231940 AGCAAGTCAAACTCCAGAGTGGG + Intronic
1183523836 22:38312137-38312159 CTGAGATCACACTCCAGCGTGGG - Intronic
1183747482 22:39699973-39699995 GACAGTGCACACTCCAGAGATGG - Intergenic
950812745 3:15665334-15665356 CACAGTTAACACACCAGAGAGGG + Intergenic
951963101 3:28350457-28350479 CACAGTGCACACTACACAGTGGG + Intronic
952041650 3:29268467-29268489 CACATGCCACACCCCAAAGTTGG + Intergenic
953304037 3:41809611-41809633 CAGAGGTGACACTGCAGAGCAGG - Intronic
953304683 3:41817005-41817027 CAGAGGTGACACTGCAGAGCAGG + Intronic
953913371 3:46903905-46903927 CTCAGGTCTCACTTCAGAATGGG + Intergenic
953955029 3:47225246-47225268 CCCATGTCAGCCTCCAGAGTAGG - Intergenic
956113299 3:65892993-65893015 CCCAGGTAACACACCAGAGAAGG + Intronic
959048992 3:101506499-101506521 CACCGGTCATATTCCAGAGATGG + Intronic
962504062 3:136028128-136028150 CAGAGTTCTCCCTCCAGAGTGGG + Intronic
971099995 4:23455608-23455630 GCAAGGTCACACTCCAGGGTTGG + Intergenic
971762828 4:30790398-30790420 CAGAGGTCACACTCAACAGGAGG + Intronic
980098497 4:128518109-128518131 CAAAGGTCAAACTCCAGATGTGG + Intergenic
982576346 4:157114982-157115004 CACAGCTCACACTAAGGAGTGGG + Intronic
986270140 5:6222963-6222985 CTCAGTTCACACTTCAGAGGAGG - Intergenic
987647014 5:20686747-20686769 CACAGGTGCCACTGCAGAGTAGG - Intergenic
990513065 5:56506750-56506772 CCAAGGTCACATTCCAGAGAAGG - Intergenic
992392584 5:76342565-76342587 CACAGGGCACACTCTGGAGCTGG + Intronic
996153689 5:120071837-120071859 CAAAGGTCAAACTCCTGATTTGG - Intergenic
999114452 5:149150136-149150158 CCCAGGGCACAGTCCAGAGTAGG + Intronic
999233677 5:150077979-150078001 CACAGCTCAGACTCCAGAGAGGG - Intronic
999397784 5:151241247-151241269 CTCAGGTTACACACCAGGGTGGG - Intronic
1002781026 6:366116-366138 CACAGGGCAGCCTCCAGAGCTGG + Intergenic
1004111950 6:12727324-12727346 CCCAGGGCACACTCCAGAACAGG - Intronic
1004857141 6:19762755-19762777 CACACCTCAGCCTCCAGAGTAGG + Intergenic
1007163236 6:39809872-39809894 CAGCAGACACACTCCAGAGTTGG + Intronic
1007253361 6:40511542-40511564 CAGAGCACACACTCCAGAGCTGG - Intronic
1008974221 6:57405572-57405594 CACAGGTAAAAATCCAGAGCTGG - Intronic
1009163110 6:60307095-60307117 CACAGGTAAAAATCCAGAGCTGG - Intergenic
1012620875 6:101341907-101341929 TCCAGGTCACACTGCAGAGAGGG - Intergenic
1013663302 6:112320904-112320926 GACATCTCACACTCCAGATTGGG + Intergenic
1016224940 6:141723526-141723548 CACAGTTCACACCCCAAAGAGGG + Intergenic
1019614828 7:1954484-1954506 CACAGGGCACACTCAGGAGGTGG + Intronic
1020108696 7:5435601-5435623 CACAGGTCACATGCCAGACCTGG + Intronic
1023464581 7:40440041-40440063 GAAAGTTCACACTGCAGAGTAGG - Intronic
1026085495 7:67259770-67259792 CACAGGACAGACTCCAAAATTGG - Intergenic
1026691671 7:72555103-72555125 CACAGGACAGACTCCAAAATTGG + Intergenic
1026953204 7:74361045-74361067 CACAGGTCTCAGTCCAGGGTTGG - Intronic
1027972411 7:85102330-85102352 CACAGGTCACACTCCAGAGTAGG - Intronic
1028903402 7:96126143-96126165 CACAGGTCTCTCTCCTGAATGGG + Intronic
1033044183 7:137946167-137946189 CACAGGCCACACTCAAGGGAAGG - Intronic
1033739021 7:144254599-144254621 CACAGGAAGCACTCAAGAGTAGG - Intergenic
1033744024 7:144296355-144296377 CACAGGAAGCACTCAAGAGTAGG + Intergenic
1035140106 7:156751281-156751303 CACAAGGCTCACTCCAGAGTGGG + Intronic
1037816114 8:22112965-22112987 CACAGGAAATACTCCAGATTTGG + Intergenic
1037918910 8:22790279-22790301 AGGAGGTCACAGTCCAGAGTGGG + Intronic
1040979538 8:53231996-53232018 CAAACGTCCCACTACAGAGTTGG + Intronic
1041857023 8:62469034-62469056 CACAGGTGACAGGCCAGAGGAGG - Intronic
1045380867 8:101623924-101623946 AACAGGTCACAGTACACAGTAGG + Intronic
1045641431 8:104255801-104255823 CACATTTCACAGTCCAGAGGTGG - Intronic
1046762437 8:118035269-118035291 TCCAAGTCACTCTCCAGAGTCGG + Intronic
1048301185 8:133252568-133252590 CAGAGGCCCCACTCCGGAGTTGG - Intronic
1048301194 8:133252608-133252630 CAGAGGCCCCACTCCGGAGTTGG - Intronic
1049569264 8:143360787-143360809 CACAGGACACAGTTCCGAGTGGG + Intergenic
1050126989 9:2367674-2367696 AGCAGGGCACACTCCAGAGGTGG - Intergenic
1051938370 9:22472303-22472325 CACAGGTGACATGCCAGATTTGG - Intergenic
1052541429 9:29816567-29816589 GGCAGGGCACACTCCAGAGGTGG - Intergenic
1053668171 9:40331880-40331902 CCCAGCTCAGACTCCTGAGTAGG - Intergenic
1053917973 9:42958175-42958197 CCCAGCTCAGACTCCTGAGTAGG - Intergenic
1054379315 9:64471936-64471958 CCCAGCTCAGACTCCTGAGTAGG - Intergenic
1054516441 9:66044413-66044435 CCCAGCTCAGACTCCTGAGTAGG + Intergenic
1057283969 9:93733193-93733215 CACAGTTAAAACTGCAGAGTTGG + Intergenic
1061054729 9:128216321-128216343 CCAAGGTCACACAGCAGAGTGGG - Intronic
1061337594 9:129951551-129951573 CGCATTTCACCCTCCAGAGTAGG + Intronic
1061789759 9:133052780-133052802 CACAGGTCGCTCTCCTGAGCCGG - Intronic
1062361003 9:136188038-136188060 CATTGGTGACCCTCCAGAGTTGG - Intergenic
1187300436 X:18043966-18043988 CACAGGTCACATGACAAAGTAGG + Intergenic
1193075930 X:77355623-77355645 CCCAGGAAAGACTCCAGAGTTGG + Intergenic
1193864519 X:86714682-86714704 CACAGTCCACTCTCCAGAGCTGG + Exonic
1195342786 X:103921171-103921193 CACAGGCCACAATCCTGAGATGG - Intronic
1199488282 X:148371760-148371782 CACAGGTCCTACTCAAGACTTGG - Intergenic
1201629273 Y:16051642-16051664 GGCAGTTCACACTCCAGATTGGG - Intergenic