ID: 1027972415

View in Genome Browser
Species Human (GRCh38)
Location 7:85102348-85102370
Sequence CTGTGTCAGGGCAAAGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027972411_1027972415 -5 Left 1027972411 7:85102330-85102352 CCTACTCTGGAGTGTGACCTGTG 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1027972415 7:85102348-85102370 CTGTGTCAGGGCAAAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027972415 Original CRISPR CTGTGTCAGGGCAAAGACCA TGG Intronic
No off target data available for this crispr