ID: 1027977857

View in Genome Browser
Species Human (GRCh38)
Location 7:85181822-85181844
Sequence AAAATTATGAAACATGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027977856_1027977857 -6 Left 1027977856 7:85181805-85181827 CCTGGTTGATGGCTGTTAAAATT 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1027977857 7:85181822-85181844 AAAATTATGAAACATGAACATGG No data
1027977853_1027977857 27 Left 1027977853 7:85181772-85181794 CCAGTGAAAGATTAGCATGCTAG 0: 1
1: 1
2: 3
3: 4
4: 79
Right 1027977857 7:85181822-85181844 AAAATTATGAAACATGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027977857 Original CRISPR AAAATTATGAAACATGAACA TGG Intronic
No off target data available for this crispr