ID: 1027978472

View in Genome Browser
Species Human (GRCh38)
Location 7:85186903-85186925
Sequence GCCTGTCCTAGCGCGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027978472_1027978479 8 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978479 7:85186934-85186956 AGGCACCAGCTGGAGCTTTGGGG No data
1027978472_1027978482 16 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978482 7:85186942-85186964 GCTGGAGCTTTGGGGAGGAGAGG No data
1027978472_1027978476 -2 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978476 7:85186924-85186946 GCGGAGAGCAAGGCACCAGCTGG No data
1027978472_1027978478 7 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978478 7:85186933-85186955 AAGGCACCAGCTGGAGCTTTGGG No data
1027978472_1027978485 25 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978485 7:85186951-85186973 TTGGGGAGGAGAGGGTGGCGAGG No data
1027978472_1027978477 6 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978477 7:85186932-85186954 CAAGGCACCAGCTGGAGCTTTGG No data
1027978472_1027978483 17 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978483 7:85186943-85186965 CTGGAGCTTTGGGGAGGAGAGGG No data
1027978472_1027978480 11 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978480 7:85186937-85186959 CACCAGCTGGAGCTTTGGGGAGG No data
1027978472_1027978484 20 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978484 7:85186946-85186968 GAGCTTTGGGGAGGAGAGGGTGG No data
1027978472_1027978486 30 Left 1027978472 7:85186903-85186925 CCGAGAGCCGCGCTAGGACAGGC No data
Right 1027978486 7:85186956-85186978 GAGGAGAGGGTGGCGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027978472 Original CRISPR GCCTGTCCTAGCGCGGCTCT CGG (reversed) Intergenic