ID: 1027979056

View in Genome Browser
Species Human (GRCh38)
Location 7:85193831-85193853
Sequence TTGTTGTTATTGTTGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027979056_1027979057 -1 Left 1027979056 7:85193831-85193853 CCATCTTTCAACAATAACAACAA No data
Right 1027979057 7:85193853-85193875 AAAATTATAAACCATACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027979056 Original CRISPR TTGTTGTTATTGTTGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr