ID: 1027984060

View in Genome Browser
Species Human (GRCh38)
Location 7:85262853-85262875
Sequence CTCTCTATGCATAAGGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027984054_1027984060 7 Left 1027984054 7:85262823-85262845 CCATGAATAAGAATACATAAATA No data
Right 1027984060 7:85262853-85262875 CTCTCTATGCATAAGGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027984060 Original CRISPR CTCTCTATGCATAAGGGGGT AGG Intergenic
No off target data available for this crispr