ID: 1027987911

View in Genome Browser
Species Human (GRCh38)
Location 7:85318551-85318573
Sequence CAGTGGGTAGGGCTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027987911_1027987925 17 Left 1027987911 7:85318551-85318573 CCCTCCCCCAGCCCTACCCACTG No data
Right 1027987925 7:85318591-85318613 TTGTTCCCCTCCCTGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027987911 Original CRISPR CAGTGGGTAGGGCTGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr