ID: 1027996915

View in Genome Browser
Species Human (GRCh38)
Location 7:85435690-85435712
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027996912_1027996915 -7 Left 1027996912 7:85435674-85435696 CCAGTCTTGGGTATGTCTTTATC No data
Right 1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG No data
1027996911_1027996915 -6 Left 1027996911 7:85435673-85435695 CCCAGTCTTGGGTATGTCTTTAT No data
Right 1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG No data
1027996908_1027996915 14 Left 1027996908 7:85435653-85435675 CCTCTTTCTTTTGTAAACTGCCC No data
Right 1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027996915 Original CRISPR CTTTATCAGCAGAGGGAAAA TGG Intergenic
No off target data available for this crispr