ID: 1027998213

View in Genome Browser
Species Human (GRCh38)
Location 7:85454528-85454550
Sequence CTGAACAATAGGAAGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027998213_1027998223 18 Left 1027998213 7:85454528-85454550 CCCCCAGCCTTCCTATTGTTCAG No data
Right 1027998223 7:85454569-85454591 TGGTCCACACAATAGCTTAGAGG No data
1027998213_1027998221 -7 Left 1027998213 7:85454528-85454550 CCCCCAGCCTTCCTATTGTTCAG No data
Right 1027998221 7:85454544-85454566 TGTTCAGTGGGACAGTTTGAAGG No data
1027998213_1027998222 -2 Left 1027998213 7:85454528-85454550 CCCCCAGCCTTCCTATTGTTCAG No data
Right 1027998222 7:85454549-85454571 AGTGGGACAGTTTGAAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027998213 Original CRISPR CTGAACAATAGGAAGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr