ID: 1027998213 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:85454528-85454550 |
Sequence | CTGAACAATAGGAAGGCTGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027998213_1027998223 | 18 | Left | 1027998213 | 7:85454528-85454550 | CCCCCAGCCTTCCTATTGTTCAG | No data | ||
Right | 1027998223 | 7:85454569-85454591 | TGGTCCACACAATAGCTTAGAGG | No data | ||||
1027998213_1027998221 | -7 | Left | 1027998213 | 7:85454528-85454550 | CCCCCAGCCTTCCTATTGTTCAG | No data | ||
Right | 1027998221 | 7:85454544-85454566 | TGTTCAGTGGGACAGTTTGAAGG | No data | ||||
1027998213_1027998222 | -2 | Left | 1027998213 | 7:85454528-85454550 | CCCCCAGCCTTCCTATTGTTCAG | No data | ||
Right | 1027998222 | 7:85454549-85454571 | AGTGGGACAGTTTGAAGGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027998213 | Original CRISPR | CTGAACAATAGGAAGGCTGG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |