ID: 1027998958 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:85466757-85466779 |
| Sequence | AGCTGGAGTATACTGCTGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1027998958_1027998962 | -6 | Left | 1027998958 | 7:85466757-85466779 | CCAGACAGCAGTATACTCCAGCT | No data | ||
| Right | 1027998962 | 7:85466774-85466796 | CCAGCTGTGCAGGAGGTGCAAGG | No data | ||||
| 1027998958_1027998963 | 17 | Left | 1027998958 | 7:85466757-85466779 | CCAGACAGCAGTATACTCCAGCT | No data | ||
| Right | 1027998963 | 7:85466797-85466819 | ACCATTAACCCACAACTACATGG | No data | ||||
| 1027998958_1027998967 | 26 | Left | 1027998958 | 7:85466757-85466779 | CCAGACAGCAGTATACTCCAGCT | No data | ||
| Right | 1027998967 | 7:85466806-85466828 | CCACAACTACATGGAAAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1027998958 | Original CRISPR | AGCTGGAGTATACTGCTGTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||