ID: 1027998958

View in Genome Browser
Species Human (GRCh38)
Location 7:85466757-85466779
Sequence AGCTGGAGTATACTGCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027998958_1027998962 -6 Left 1027998958 7:85466757-85466779 CCAGACAGCAGTATACTCCAGCT No data
Right 1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG No data
1027998958_1027998963 17 Left 1027998958 7:85466757-85466779 CCAGACAGCAGTATACTCCAGCT No data
Right 1027998963 7:85466797-85466819 ACCATTAACCCACAACTACATGG No data
1027998958_1027998967 26 Left 1027998958 7:85466757-85466779 CCAGACAGCAGTATACTCCAGCT No data
Right 1027998967 7:85466806-85466828 CCACAACTACATGGAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027998958 Original CRISPR AGCTGGAGTATACTGCTGTC TGG (reversed) Intergenic
No off target data available for this crispr