ID: 1027998962

View in Genome Browser
Species Human (GRCh38)
Location 7:85466774-85466796
Sequence CCAGCTGTGCAGGAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027998958_1027998962 -6 Left 1027998958 7:85466757-85466779 CCAGACAGCAGTATACTCCAGCT No data
Right 1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027998962 Original CRISPR CCAGCTGTGCAGGAGGTGCA AGG Intergenic
No off target data available for this crispr