ID: 1028002254

View in Genome Browser
Species Human (GRCh38)
Location 7:85513998-85514020
Sequence CTCACCAGGTTTTCTTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028002254_1028002260 6 Left 1028002254 7:85513998-85514020 CCTAACAAAGAAAACCTGGTGAG No data
Right 1028002260 7:85514027-85514049 AGAGGAAAGGATGAAAATGTGGG No data
1028002254_1028002261 9 Left 1028002254 7:85513998-85514020 CCTAACAAAGAAAACCTGGTGAG No data
Right 1028002261 7:85514030-85514052 GGAAAGGATGAAAATGTGGGAGG No data
1028002254_1028002259 5 Left 1028002254 7:85513998-85514020 CCTAACAAAGAAAACCTGGTGAG No data
Right 1028002259 7:85514026-85514048 TAGAGGAAAGGATGAAAATGTGG No data
1028002254_1028002258 -7 Left 1028002254 7:85513998-85514020 CCTAACAAAGAAAACCTGGTGAG No data
Right 1028002258 7:85514014-85514036 TGGTGAGGTTTCTAGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028002254 Original CRISPR CTCACCAGGTTTTCTTTGTT AGG (reversed) Intergenic
No off target data available for this crispr