ID: 1028005568

View in Genome Browser
Species Human (GRCh38)
Location 7:85562178-85562200
Sequence CTTGACTCATTGGTGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028005568_1028005570 -6 Left 1028005568 7:85562178-85562200 CCAGTTTTCACCAATGAGTCAAG No data
Right 1028005570 7:85562195-85562217 GTCAAGTCAAAATCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028005568 Original CRISPR CTTGACTCATTGGTGAAAAC TGG (reversed) Intergenic
No off target data available for this crispr