ID: 1028018077

View in Genome Browser
Species Human (GRCh38)
Location 7:85739765-85739787
Sequence TCTTGCGCCTTAACAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028018077_1028018083 11 Left 1028018077 7:85739765-85739787 CCTGCATTTGTTAAGGCGCAAGA No data
Right 1028018083 7:85739799-85739821 TGGAGTCTGTTATTTTAAAGGGG No data
1028018077_1028018080 -9 Left 1028018077 7:85739765-85739787 CCTGCATTTGTTAAGGCGCAAGA No data
Right 1028018080 7:85739779-85739801 GGCGCAAGAGTCTTGGTAGGTGG No data
1028018077_1028018081 9 Left 1028018077 7:85739765-85739787 CCTGCATTTGTTAAGGCGCAAGA No data
Right 1028018081 7:85739797-85739819 GGTGGAGTCTGTTATTTTAAAGG No data
1028018077_1028018082 10 Left 1028018077 7:85739765-85739787 CCTGCATTTGTTAAGGCGCAAGA No data
Right 1028018082 7:85739798-85739820 GTGGAGTCTGTTATTTTAAAGGG No data
1028018077_1028018084 30 Left 1028018077 7:85739765-85739787 CCTGCATTTGTTAAGGCGCAAGA No data
Right 1028018084 7:85739818-85739840 GGGGCAGAGATACTTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028018077 Original CRISPR TCTTGCGCCTTAACAAATGC AGG (reversed) Intergenic
No off target data available for this crispr