ID: 1028018081

View in Genome Browser
Species Human (GRCh38)
Location 7:85739797-85739819
Sequence GGTGGAGTCTGTTATTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028018077_1028018081 9 Left 1028018077 7:85739765-85739787 CCTGCATTTGTTAAGGCGCAAGA No data
Right 1028018081 7:85739797-85739819 GGTGGAGTCTGTTATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028018081 Original CRISPR GGTGGAGTCTGTTATTTTAA AGG Intergenic
No off target data available for this crispr