ID: 1028018486

View in Genome Browser
Species Human (GRCh38)
Location 7:85743381-85743403
Sequence TCACCTTCTTAGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028018486_1028018488 -8 Left 1028018486 7:85743381-85743403 CCCTGAATCAACTAAGAAGGTGA No data
Right 1028018488 7:85743396-85743418 GAAGGTGATAAACTCATGTTTGG No data
1028018486_1028018490 16 Left 1028018486 7:85743381-85743403 CCCTGAATCAACTAAGAAGGTGA No data
Right 1028018490 7:85743420-85743442 TCCCACGTCTAAATTTATCAAGG No data
1028018486_1028018492 17 Left 1028018486 7:85743381-85743403 CCCTGAATCAACTAAGAAGGTGA No data
Right 1028018492 7:85743421-85743443 CCCACGTCTAAATTTATCAAGGG No data
1028018486_1028018495 28 Left 1028018486 7:85743381-85743403 CCCTGAATCAACTAAGAAGGTGA No data
Right 1028018495 7:85743432-85743454 ATTTATCAAGGGCTCTTGGTAGG No data
1028018486_1028018489 -7 Left 1028018486 7:85743381-85743403 CCCTGAATCAACTAAGAAGGTGA No data
Right 1028018489 7:85743397-85743419 AAGGTGATAAACTCATGTTTGGG No data
1028018486_1028018494 24 Left 1028018486 7:85743381-85743403 CCCTGAATCAACTAAGAAGGTGA No data
Right 1028018494 7:85743428-85743450 CTAAATTTATCAAGGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028018486 Original CRISPR TCACCTTCTTAGTTGATTCA GGG (reversed) Intergenic