ID: 1028018506

View in Genome Browser
Species Human (GRCh38)
Location 7:85743497-85743519
Sequence CCTTCCACTCATGACTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028018506_1028018513 21 Left 1028018506 7:85743497-85743519 CCCCAAAAGTCATGAGTGGAAGG No data
Right 1028018513 7:85743541-85743563 CAGGATATTCTCTCTTGAAATGG No data
1028018506_1028018511 2 Left 1028018506 7:85743497-85743519 CCCCAAAAGTCATGAGTGGAAGG No data
Right 1028018511 7:85743522-85743544 TTCTTTTCCTTTTCTAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028018506 Original CRISPR CCTTCCACTCATGACTTTTG GGG (reversed) Intergenic
No off target data available for this crispr