ID: 1028018650

View in Genome Browser
Species Human (GRCh38)
Location 7:85744517-85744539
Sequence CCTTAGGTGTGGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028018639_1028018650 20 Left 1028018639 7:85744474-85744496 CCTTGTGGCACCTCTTTTTAGGG No data
Right 1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG No data
1028018642_1028018650 10 Left 1028018642 7:85744484-85744506 CCTCTTTTTAGGGGAAGAGAGTT No data
Right 1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG No data
1028018637_1028018650 23 Left 1028018637 7:85744471-85744493 CCTCCTTGTGGCACCTCTTTTTA No data
Right 1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG No data
1028018636_1028018650 26 Left 1028018636 7:85744468-85744490 CCTCCTCCTTGTGGCACCTCTTT No data
Right 1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028018650 Original CRISPR CCTTAGGTGTGGAGGGAAGT GGG Intergenic
No off target data available for this crispr