ID: 1028026115

View in Genome Browser
Species Human (GRCh38)
Location 7:85842977-85842999
Sequence ACTGATATGCAGAATTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028026115_1028026120 24 Left 1028026115 7:85842977-85842999 CCTTATAAATTCTGCATATCAGT No data
Right 1028026120 7:85843024-85843046 AATAATTTGTCTCACTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028026115 Original CRISPR ACTGATATGCAGAATTTATA AGG (reversed) Intergenic
No off target data available for this crispr