ID: 1028030954

View in Genome Browser
Species Human (GRCh38)
Location 7:85911881-85911903
Sequence AGCTAAGAATACAGCTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028030950_1028030954 28 Left 1028030950 7:85911830-85911852 CCAAATTAGGAAGGCAATCCCAT No data
Right 1028030954 7:85911881-85911903 AGCTAAGAATACAGCTGATCAGG No data
1028030952_1028030954 9 Left 1028030952 7:85911849-85911871 CCATTCACAATTGCCACAAAAAA 0: 47
1: 499
2: 1340
3: 4557
4: 14989
Right 1028030954 7:85911881-85911903 AGCTAAGAATACAGCTGATCAGG No data
1028030951_1028030954 10 Left 1028030951 7:85911848-85911870 CCCATTCACAATTGCCACAAAAA 0: 356
1: 889
2: 3601
3: 12888
4: 5608
Right 1028030954 7:85911881-85911903 AGCTAAGAATACAGCTGATCAGG No data
1028030953_1028030954 -4 Left 1028030953 7:85911862-85911884 CCACAAAAAAATATAAGATAGCT No data
Right 1028030954 7:85911881-85911903 AGCTAAGAATACAGCTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028030954 Original CRISPR AGCTAAGAATACAGCTGATC AGG Intergenic
No off target data available for this crispr