ID: 1028032929

View in Genome Browser
Species Human (GRCh38)
Location 7:85940628-85940650
Sequence CTTTTGATTAATAGCATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028032929_1028032933 -8 Left 1028032929 7:85940628-85940650 CCATGGATGCTATTAATCAAAAG No data
Right 1028032933 7:85940643-85940665 ATCAAAAGAGAAGGCAGGGAAGG No data
1028032929_1028032934 29 Left 1028032929 7:85940628-85940650 CCATGGATGCTATTAATCAAAAG No data
Right 1028032934 7:85940680-85940702 AAATCTTTCAGAAATAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028032929 Original CRISPR CTTTTGATTAATAGCATCCA TGG (reversed) Intergenic
No off target data available for this crispr