ID: 1028035086

View in Genome Browser
Species Human (GRCh38)
Location 7:85972200-85972222
Sequence GCTCTGAGAAGACCTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028035082_1028035086 27 Left 1028035082 7:85972150-85972172 CCAATGGAGGGTTAGCAAGGTGG No data
Right 1028035086 7:85972200-85972222 GCTCTGAGAAGACCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028035086 Original CRISPR GCTCTGAGAAGACCTGAAGT GGG Intergenic
No off target data available for this crispr