ID: 1028042159

View in Genome Browser
Species Human (GRCh38)
Location 7:86066478-86066500
Sequence TGAGTTCCAAACAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028042157_1028042159 1 Left 1028042157 7:86066454-86066476 CCTTTTAGTTATCAAGTTTCACA No data
Right 1028042159 7:86066478-86066500 TGAGTTCCAAACAAAGAGGCTGG No data
1028042156_1028042159 2 Left 1028042156 7:86066453-86066475 CCCTTTTAGTTATCAAGTTTCAC No data
Right 1028042159 7:86066478-86066500 TGAGTTCCAAACAAAGAGGCTGG No data
1028042155_1028042159 3 Left 1028042155 7:86066452-86066474 CCCCTTTTAGTTATCAAGTTTCA No data
Right 1028042159 7:86066478-86066500 TGAGTTCCAAACAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028042159 Original CRISPR TGAGTTCCAAACAAAGAGGC TGG Intergenic
No off target data available for this crispr