ID: 1028042604

View in Genome Browser
Species Human (GRCh38)
Location 7:86073912-86073934
Sequence GAATCCTTCTATAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028042604_1028042607 0 Left 1028042604 7:86073912-86073934 CCCTCACTCTTATAGAAGGATTC No data
Right 1028042607 7:86073935-86073957 TAACCTAGGAATTCCAGTGTAGG No data
1028042604_1028042610 13 Left 1028042604 7:86073912-86073934 CCCTCACTCTTATAGAAGGATTC No data
Right 1028042610 7:86073948-86073970 CCAGTGTAGGAAATTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028042604 Original CRISPR GAATCCTTCTATAAGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr