ID: 1028043856

View in Genome Browser
Species Human (GRCh38)
Location 7:86091436-86091458
Sequence GTTATCTGCAGAAAAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028043856_1028043860 5 Left 1028043856 7:86091436-86091458 CCCAGCCCTTTTCTGCAGATAAC No data
Right 1028043860 7:86091464-86091486 TACTTTTGAAAGATAGTTCTTGG No data
1028043856_1028043862 23 Left 1028043856 7:86091436-86091458 CCCAGCCCTTTTCTGCAGATAAC No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data
1028043856_1028043861 17 Left 1028043856 7:86091436-86091458 CCCAGCCCTTTTCTGCAGATAAC No data
Right 1028043861 7:86091476-86091498 ATAGTTCTTGGCCTGTTACTAGG No data
1028043856_1028043863 26 Left 1028043856 7:86091436-86091458 CCCAGCCCTTTTCTGCAGATAAC No data
Right 1028043863 7:86091485-86091507 GGCCTGTTACTAGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028043856 Original CRISPR GTTATCTGCAGAAAAGGGCT GGG (reversed) Intergenic
No off target data available for this crispr