ID: 1028043858

View in Genome Browser
Species Human (GRCh38)
Location 7:86091441-86091463
Sequence GAGTAGTTATCTGCAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028043858_1028043863 21 Left 1028043858 7:86091441-86091463 CCCTTTTCTGCAGATAACTACTC No data
Right 1028043863 7:86091485-86091507 GGCCTGTTACTAGGCTTTGGTGG No data
1028043858_1028043860 0 Left 1028043858 7:86091441-86091463 CCCTTTTCTGCAGATAACTACTC No data
Right 1028043860 7:86091464-86091486 TACTTTTGAAAGATAGTTCTTGG No data
1028043858_1028043861 12 Left 1028043858 7:86091441-86091463 CCCTTTTCTGCAGATAACTACTC No data
Right 1028043861 7:86091476-86091498 ATAGTTCTTGGCCTGTTACTAGG No data
1028043858_1028043862 18 Left 1028043858 7:86091441-86091463 CCCTTTTCTGCAGATAACTACTC No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028043858 Original CRISPR GAGTAGTTATCTGCAGAAAA GGG (reversed) Intergenic
No off target data available for this crispr