ID: 1028043859

View in Genome Browser
Species Human (GRCh38)
Location 7:86091442-86091464
Sequence AGAGTAGTTATCTGCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028043859_1028043862 17 Left 1028043859 7:86091442-86091464 CCTTTTCTGCAGATAACTACTCT No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data
1028043859_1028043861 11 Left 1028043859 7:86091442-86091464 CCTTTTCTGCAGATAACTACTCT No data
Right 1028043861 7:86091476-86091498 ATAGTTCTTGGCCTGTTACTAGG No data
1028043859_1028043863 20 Left 1028043859 7:86091442-86091464 CCTTTTCTGCAGATAACTACTCT No data
Right 1028043863 7:86091485-86091507 GGCCTGTTACTAGGCTTTGGTGG No data
1028043859_1028043860 -1 Left 1028043859 7:86091442-86091464 CCTTTTCTGCAGATAACTACTCT No data
Right 1028043860 7:86091464-86091486 TACTTTTGAAAGATAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028043859 Original CRISPR AGAGTAGTTATCTGCAGAAA AGG (reversed) Intergenic
No off target data available for this crispr