ID: 1028043862

View in Genome Browser
Species Human (GRCh38)
Location 7:86091482-86091504
Sequence CTTGGCCTGTTACTAGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028043859_1028043862 17 Left 1028043859 7:86091442-86091464 CCTTTTCTGCAGATAACTACTCT No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data
1028043858_1028043862 18 Left 1028043858 7:86091441-86091463 CCCTTTTCTGCAGATAACTACTC No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data
1028043856_1028043862 23 Left 1028043856 7:86091436-86091458 CCCAGCCCTTTTCTGCAGATAAC No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data
1028043857_1028043862 22 Left 1028043857 7:86091437-86091459 CCAGCCCTTTTCTGCAGATAACT No data
Right 1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028043862 Original CRISPR CTTGGCCTGTTACTAGGCTT TGG Intergenic
No off target data available for this crispr