ID: 1028058759

View in Genome Browser
Species Human (GRCh38)
Location 7:86282449-86282471
Sequence AGTCTGGGTGGGCCCGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028058759_1028058769 18 Left 1028058759 7:86282449-86282471 CCGAGTGCGGGCCCACCCAGACT No data
Right 1028058769 7:86282490-86282512 CGCTGGCCCGCGAGCAGCCTCGG No data
1028058759_1028058765 1 Left 1028058759 7:86282449-86282471 CCGAGTGCGGGCCCACCCAGACT No data
Right 1028058765 7:86282473-86282495 CACCCACCGGCAGCTCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028058759 Original CRISPR AGTCTGGGTGGGCCCGCACT CGG (reversed) Intergenic