ID: 1028070769

View in Genome Browser
Species Human (GRCh38)
Location 7:86447326-86447348
Sequence CAGAACAGAAAGAAGTAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028070768_1028070769 -3 Left 1028070768 7:86447306-86447328 CCTGAGTAGCATAGATGAGTCAG No data
Right 1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028070769 Original CRISPR CAGAACAGAAAGAAGTAGTG AGG Intergenic
No off target data available for this crispr