ID: 1028078337

View in Genome Browser
Species Human (GRCh38)
Location 7:86543136-86543158
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028078335_1028078337 9 Left 1028078335 7:86543104-86543126 CCATGTTGTTCATGCTAGTCTTG No data
Right 1028078337 7:86543136-86543158 GCTCAGAGATTCACCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028078337 Original CRISPR GCTCAGAGATTCACCCACCT TGG Intergenic
No off target data available for this crispr