ID: 1028078779

View in Genome Browser
Species Human (GRCh38)
Location 7:86548247-86548269
Sequence GAGGATGAGCTGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028078779_1028078788 25 Left 1028078779 7:86548247-86548269 CCATCCTGCTTCAGCTCATCCTC No data
Right 1028078788 7:86548295-86548317 AGTCCCAGTGAGATGAACCAGGG No data
1028078779_1028078787 24 Left 1028078779 7:86548247-86548269 CCATCCTGCTTCAGCTCATCCTC No data
Right 1028078787 7:86548294-86548316 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028078779 Original CRISPR GAGGATGAGCTGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr