ID: 1028078779 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:86548247-86548269 |
| Sequence | GAGGATGAGCTGAAGCAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1028078779_1028078788 | 25 | Left | 1028078779 | 7:86548247-86548269 | CCATCCTGCTTCAGCTCATCCTC | No data | ||
| Right | 1028078788 | 7:86548295-86548317 | AGTCCCAGTGAGATGAACCAGGG | No data | ||||
| 1028078779_1028078787 | 24 | Left | 1028078779 | 7:86548247-86548269 | CCATCCTGCTTCAGCTCATCCTC | No data | ||
| Right | 1028078787 | 7:86548294-86548316 | CAGTCCCAGTGAGATGAACCAGG | 0: 320 1: 800 2: 1270 3: 925 4: 1105 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1028078779 | Original CRISPR | GAGGATGAGCTGAAGCAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||