ID: 1028082742

View in Genome Browser
Species Human (GRCh38)
Location 7:86598949-86598971
Sequence CCCTGGAGGTGGGGGAGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028082730_1028082742 14 Left 1028082730 7:86598912-86598934 CCGCTGGGAGCAGTGTTACATCT No data
Right 1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG No data
1028082728_1028082742 22 Left 1028082728 7:86598904-86598926 CCAGCCAGCCGCTGGGAGCAGTG No data
Right 1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG No data
1028082729_1028082742 18 Left 1028082729 7:86598908-86598930 CCAGCCGCTGGGAGCAGTGTTAC No data
Right 1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028082742 Original CRISPR CCCTGGAGGTGGGGGAGTAG GGG Intergenic
No off target data available for this crispr