ID: 1028083047

View in Genome Browser
Species Human (GRCh38)
Location 7:86600831-86600853
Sequence GCTTTACTTGCCCCACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028083044_1028083047 20 Left 1028083044 7:86600788-86600810 CCTCACATCACTTTGCTGATGCA No data
Right 1028083047 7:86600831-86600853 GCTTTACTTGCCCCACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028083047 Original CRISPR GCTTTACTTGCCCCACTAGC AGG Intergenic
No off target data available for this crispr