ID: 1028090887

View in Genome Browser
Species Human (GRCh38)
Location 7:86699334-86699356
Sequence ATCCAGATGCAGAATCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028090882_1028090887 1 Left 1028090882 7:86699310-86699332 CCACCCCTTGTGAGTTATAAGTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG 0: 1
1: 0
2: 0
3: 23
4: 205
1028090881_1028090887 26 Left 1028090881 7:86699285-86699307 CCTATTAGCTTGAAATTTTCTCT 0: 1
1: 0
2: 5
3: 38
4: 358
Right 1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG 0: 1
1: 0
2: 0
3: 23
4: 205
1028090885_1028090887 -4 Left 1028090885 7:86699315-86699337 CCTTGTGAGTTATAAGTCAATCC 0: 1
1: 0
2: 0
3: 3
4: 132
Right 1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG 0: 1
1: 0
2: 0
3: 23
4: 205
1028090884_1028090887 -3 Left 1028090884 7:86699314-86699336 CCCTTGTGAGTTATAAGTCAATC 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG 0: 1
1: 0
2: 0
3: 23
4: 205
1028090883_1028090887 -2 Left 1028090883 7:86699313-86699335 CCCCTTGTGAGTTATAAGTCAAT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG 0: 1
1: 0
2: 0
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028090887 Original CRISPR ATCCAGATGCAGAATCTGGA TGG Intronic
901819210 1:11815689-11815711 TTCAAAATGCAGAATCTGGCTGG - Intronic
905282011 1:36855275-36855297 AGCCCGATTCAGAATCTGCAAGG - Intronic
907808939 1:57849317-57849339 ATCCAGATGGAGAATAAGAAAGG - Intronic
909247812 1:73310892-73310914 ACCCAGATGCAGAATCCTGCAGG + Intergenic
911234495 1:95396724-95396746 AACCAGATGGGGAAACTGGACGG + Intergenic
911237529 1:95427360-95427382 ATCCAGATGCTGACTCTACAGGG + Intergenic
911767637 1:101697952-101697974 ATCCATACTCAGAATCTTGAAGG + Intergenic
917199902 1:172503385-172503407 ATCCAGATGCAGAACCACAAAGG - Intergenic
918893592 1:190309975-190309997 TTCCAGCTGCAGACTCTGAAGGG - Intronic
923140286 1:231156165-231156187 AACCAGAGAAAGAATCTGGATGG - Intergenic
924547685 1:245045489-245045511 GTCCAGATGCAGAATCTTCTTGG + Intronic
1063192458 10:3708956-3708978 ATCAAGATGTAGATTATGGAAGG - Intergenic
1066440574 10:35435051-35435073 ATCCAGGTGCAGCCTCTGCAAGG - Intronic
1068789130 10:61008482-61008504 CTCCAGAAGTAGAATCTAGAGGG + Intergenic
1072930275 10:99656429-99656451 GTCAAGATGGAGAATATGGATGG + Intergenic
1074078717 10:110151496-110151518 ATCCAGATGCTGTCACTGGAGGG + Intergenic
1075557349 10:123443218-123443240 GGCCAGAGGCTGAATCTGGAAGG + Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1077296697 11:1829731-1829753 ATCCAGATGCAGATTCTCAGAGG + Intronic
1077652051 11:3981754-3981776 AATCATGTGCAGAATCTGGATGG + Intronic
1077900801 11:6486706-6486728 ATCCAGTTGGAGAAGCTAGAAGG + Intronic
1077947853 11:6921725-6921747 ATCCAGATGCAGTCTGGGGAAGG + Exonic
1078915143 11:15771692-15771714 ATAAAGCTGCAGACTCTGGAGGG + Intergenic
1080379778 11:31756324-31756346 AGGCAGAGGCAGAATCTGTAGGG - Intronic
1082063674 11:47881659-47881681 ATTCAGATGCAGATTCTAGGCGG + Intergenic
1082104889 11:48211081-48211103 ATGCAGATGCAGAAGCTGAGTGG + Intergenic
1083932251 11:65852453-65852475 TTTCTGATGCAGAAGCTGGAGGG + Exonic
1084919376 11:72456977-72456999 TGGCAGATGCAGAATCTTGATGG - Intergenic
1085464841 11:76716447-76716469 ATCCACATGCAGCCTCTGGAGGG + Intergenic
1086152433 11:83626803-83626825 ACCCAGAGGCAGAACCTGAAAGG - Intronic
1087069485 11:94063517-94063539 ACCCAGATGGAACATCTGGAAGG + Exonic
1087495666 11:98887893-98887915 ATCCAAATGTAAAATATGGAAGG - Intergenic
1087957581 11:104307855-104307877 TTAGAGATGTAGAATCTGGAAGG + Intergenic
1088707940 11:112480610-112480632 ATCCAGAAGCAGCATCCTGAAGG - Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1089351517 11:117824129-117824151 AGCCAGATGCAGAAAGGGGAGGG - Intronic
1089832170 11:121338347-121338369 ATCAAGATTCAGTATCAGGACGG + Intergenic
1090214021 11:124944354-124944376 AACCAGATGCAGAATCTTGGAGG - Intergenic
1091836358 12:3588848-3588870 AGCCAGTTGTACAATCTGGATGG + Intronic
1093232816 12:16568363-16568385 ATCCACATCCAGAGTATGGAGGG - Intronic
1100087229 12:90926412-90926434 ATCCAAAATCAGAATCTCGAGGG + Intronic
1105818701 13:24060701-24060723 ATCCAAATCCAGCATCTGTAAGG + Intronic
1108456763 13:50623128-50623150 AACCAGATGCAGATTCAGGGTGG - Intronic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1110762066 13:79241718-79241740 ATCCAGATGGTGAATCTCGAGGG - Intergenic
1117573434 14:57073108-57073130 ACACAGATGCAGAATCTGAGAGG + Intergenic
1119109751 14:71960429-71960451 ATCCAGATGAATCTTCTGGAAGG + Intronic
1124889769 15:33722004-33722026 ATCCAGATGAAGAATCTCCTTGG - Intronic
1125938621 15:43659054-43659076 AACCACATGCATAATCAGGAAGG + Intronic
1126001207 15:44211571-44211593 AACCAGCTGCAGATTCTAGAAGG - Intergenic
1126073311 15:44884878-44884900 ATCCAGATCCAGTATCTGATGGG - Intergenic
1128488143 15:68117577-68117599 ATCCACATGTGGAATCTGAAAGG - Intronic
1128972370 15:72118546-72118568 ATCCAGGTCCAGAATCGGGAGGG - Intronic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1133313838 16:4869765-4869787 ATCTAGATGGAGAAACTGGAGGG + Intronic
1135042528 16:19128996-19129018 ATGCATATTCAGCATCTGGAAGG - Intronic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136746968 16:32598978-32599000 TTCCAGAGGCAGAAGCTGGCAGG - Intergenic
1137581461 16:49636009-49636031 TTCCACATGCAGAAGCTGGCGGG - Exonic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1203049098 16_KI270728v1_random:858182-858204 TTCCAGAGGCAGAAGCTGGCAGG - Intergenic
1146221331 17:31024999-31025021 ATCAAGATGCATAGTATGGAAGG + Intergenic
1151523398 17:74647245-74647267 ATCCAGATGCATAAACTGTATGG + Intergenic
1153070892 18:1103089-1103111 TTCCAGCTGCAGAGGCTGGAGGG + Intergenic
1153273506 18:3346403-3346425 ATCTAGATCCAGTATCTGGAGGG + Intergenic
1153438907 18:5095540-5095562 ATCTAGATTCAGAATTTGGCTGG + Intergenic
1153976709 18:10274620-10274642 TACCAGATGCCGAGTCTGGAAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158882066 18:61789694-61789716 ATGCAGTTCCAGGATCTGGAGGG + Intergenic
1159787626 18:72733099-72733121 ATTCAGATGAGGAATCTGGAGGG + Intergenic
1162935034 19:13978022-13978044 AGCCAGGTGCAGTATGTGGAGGG - Exonic
1163468738 19:17484881-17484903 ATTTTGATGCAGAAGCTGGAGGG + Intronic
1164022051 19:21316474-21316496 CTGCAGATTCAGATTCTGGATGG + Intronic
1165186177 19:34024157-34024179 GTCCAGATGAAAAAGCTGGAGGG - Intergenic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
925104831 2:1282574-1282596 ATCCAGAGGCAGTATCTGCAAGG + Intronic
925268780 2:2587120-2587142 ACCCAGATGATGAATCTGGCCGG + Intergenic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
929123097 2:38499517-38499539 CTACAGAAGCAGAATCTGTAGGG + Intergenic
931231119 2:60375704-60375726 ATGCAGATGTAAAATCTGAAAGG - Intergenic
931233696 2:60395597-60395619 AGCCAGATGCAAAATCTGAAAGG + Intergenic
931762019 2:65426498-65426520 ATTCGGATGCAGAATCTAGCTGG + Intronic
932887647 2:75561409-75561431 AGCCTGATGCATAATCTCGAAGG + Intronic
933024305 2:77235411-77235433 ATCTTGATTCAGAATCTGCAAGG - Intronic
933929804 2:87137996-87138018 ATCCATATGCAGGTTCTGCAGGG + Intergenic
934720423 2:96571463-96571485 ATCCTGACGTAGAATCTAGATGG - Intergenic
936404135 2:112187375-112187397 ATCCTTGTGCAGAACCTGGAGGG + Exonic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
939850222 2:147295556-147295578 AGGTAGATGCAAAATCTGGATGG - Intergenic
941580033 2:167284661-167284683 AGCCAGATGCAGTATCTTGTTGG + Intergenic
941908355 2:170738476-170738498 ATCAAGAGACAGAATCTGGCCGG - Intergenic
942712468 2:178852198-178852220 AGCCAGATGCAGGATCTTGCAGG + Intronic
943221303 2:185109961-185109983 ATCCATATCCAGAACCTAGAAGG + Intergenic
943930327 2:193843314-193843336 TTCCAGCTCCAGAATCTGGCTGG + Intergenic
945274733 2:207976938-207976960 GTCCAGATGGACAACCTGGATGG - Exonic
946600928 2:221359139-221359161 ATCCAGATTCATTATCTGTAGGG + Intergenic
947239028 2:227974354-227974376 AACCAGAGGCAGGGTCTGGAAGG + Intergenic
948123128 2:235545639-235545661 TTCCAGAGGCAGAATCTGCAGGG - Intronic
948365481 2:237451935-237451957 TTCCAGAGACAGATTCTGGATGG - Intergenic
1169044028 20:2521469-2521491 ATCCAGATGTAGCCTCTGGAGGG + Intronic
1170058833 20:12238084-12238106 ATCTAGTTTCAGAATTTGGAAGG - Intergenic
1171199302 20:23228227-23228249 ATACAGTGGAAGAATCTGGACGG + Intergenic
1171340958 20:24428511-24428533 ATACAGATGGAGAATCTTGGTGG + Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172214347 20:33224470-33224492 ATACAGAAGCAGAATCTGAGAGG + Intronic
1172755742 20:37283049-37283071 ACCCACATCCAGCATCTGGATGG - Intergenic
1172839032 20:37890992-37891014 ATCTACTGGCAGAATCTGGATGG - Intergenic
1173403510 20:42745283-42745305 CGCCAGGTGCAGAAACTGGATGG - Intronic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1174829660 20:53800939-53800961 ATCTATTTGCAGAATCTGGAGGG + Intergenic
1175801637 20:61804405-61804427 GGCCAGATGCAGAGGCTGGACGG - Intronic
1176123286 20:63463848-63463870 ATACAGAGGAAGAATCTAGAAGG + Intronic
1177391471 21:20479003-20479025 ATACAAATGCTGAATTTGGAAGG - Intergenic
1178686194 21:34712658-34712680 ATCCAGAGGAACAGTCTGGAGGG + Intronic
1179113024 21:38463673-38463695 TTCCAGATGGAGAAACTGCAAGG + Intronic
1182488541 22:30654423-30654445 CTTCAGATGCACAACCTGGAGGG + Intronic
1184309347 22:43631164-43631186 ATCCAGAGGCAGAATGGAGATGG - Intronic
1184886033 22:47345001-47345023 AGACAGAGGCAGATTCTGGAGGG + Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950714202 3:14836273-14836295 AACCAGATGCAGCATCTACAAGG - Intronic
956325481 3:68047910-68047932 ATCCATTCGCATAATCTGGAAGG - Intronic
956876067 3:73464562-73464584 AACAAGATACAGAAACTGGAAGG - Intronic
957038422 3:75316453-75316475 ATTCAGATGCTGAAACTTGATGG - Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
959398750 3:105873122-105873144 ATTTAGCTGCAAAATCTGGAAGG + Intergenic
959624750 3:108437351-108437373 GACCAGATGCATAATCTAGAAGG - Intronic
961080033 3:124018810-124018832 TTCCAGATGAAGAAACTGCAGGG - Intergenic
962055407 3:131866130-131866152 TTCCACATACAGGATCTGGATGG + Intronic
962208258 3:133453712-133453734 AAAAAGATGCAGAATCTGGCAGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963002708 3:140697496-140697518 ATACAAAGGCAGAGTCTGGATGG - Intronic
964174295 3:153806671-153806693 AACCAGGTGCAGGACCTGGAGGG - Intergenic
965988901 3:174791459-174791481 CACCAGATGCAGAATCTACATGG + Intronic
967318319 3:188171424-188171446 ATCCAGATGGAGAATGAGAAAGG - Intronic
970403670 4:15741920-15741942 CTCCAGATGCATAATATGGTTGG + Intergenic
972801706 4:42482595-42482617 ATTCAGCTGAAGACTCTGGAGGG + Intronic
975967171 4:79987155-79987177 ACACAGAATCAGAATCTGGATGG + Intronic
976687239 4:87827847-87827869 AGCCAGATGCAGAATCATGGAGG - Intronic
978607070 4:110492315-110492337 AGCAAGATACAGTATCTGGAAGG - Intronic
979831047 4:125303760-125303782 ATCCAGTTGCAGAAACTATAAGG + Intergenic
980122417 4:128741584-128741606 ATCCTGAATCAGATTCTGGATGG + Intergenic
980786648 4:137564640-137564662 ATCAATATGTAGATTCTGGATGG + Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
984981827 4:185289474-185289496 ATCCTGATGCAGAAACTTGATGG + Intronic
988065648 5:26227031-26227053 ATGCAGCTGTAGAACCTGGAAGG - Intergenic
989686211 5:44090203-44090225 ATCCAGATGCAGAAGCCAGATGG - Intergenic
993772121 5:91941815-91941837 ATCCTGCTGGAGAAACTGGAGGG - Intergenic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
996367686 5:122720418-122720440 ATATAGAAGCAGTATCTGGAAGG + Intergenic
996416862 5:123220148-123220170 AGCCAGATGCAGTTACTGGATGG - Intergenic
996784603 5:127224784-127224806 AGCCACATGCAGTCTCTGGAAGG - Intergenic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
1000026645 5:157364315-157364337 ATCCAGAGGCAGACTATTGATGG + Intronic
1000087574 5:157901411-157901433 CTCCTGAAGCAGAAACTGGAGGG + Intergenic
1000581402 5:163039260-163039282 ATCCAGATGCAGATTCCAGAGGG + Intergenic
1000999561 5:167993095-167993117 TTCCAGCTGCAGTATTTGGAGGG - Exonic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1001986439 5:176077362-176077384 TTCCAGAGGCAGAAGCTGGCAGG - Intronic
1002230428 5:177760763-177760785 TTCCAGAGGCAGAAGCTGGCAGG + Intronic
1002264908 5:178022984-178023006 TTCCAGAGGCAGAAGCTGGCAGG - Intronic
1002405569 5:179027613-179027635 CTCCTGATGCAGAATCTGCCAGG + Intronic
1005872753 6:29987193-29987215 ATCCATTTGCTGAATTTGGAAGG - Intergenic
1006710371 6:36063728-36063750 ATACAGTTACTGAATCTGGATGG + Intronic
1007768611 6:44176452-44176474 AGCTAGATGGAGAATCTAGAGGG - Intronic
1007987232 6:46218983-46219005 ATCGAGATGTAGAATATTGATGG + Intergenic
1008096860 6:47347811-47347833 TTACAGATGCAGAAACTGAAGGG - Intergenic
1010516767 6:76782701-76782723 CTCCAGATATAGAATCTGGAGGG + Intergenic
1011253826 6:85401416-85401438 TACCAGATGCAGACTCAGGAAGG + Intergenic
1012445837 6:99306360-99306382 ATCCAGATGGAGCAACTGGATGG + Intronic
1012575131 6:100786154-100786176 ACCCAGATGTACAATCTGGATGG - Intronic
1013279698 6:108623995-108624017 ATTCAGATGCAAAATCTTGGTGG - Intronic
1015005589 6:128277565-128277587 ATACAGAGGCAGATTCTGAAAGG + Intronic
1015372228 6:132467011-132467033 ATCCAGATGCTCAATCTTGTTGG - Intronic
1017231011 6:152073815-152073837 TTGCAGATGCTGCATCTGGAGGG - Intronic
1017391905 6:153949287-153949309 ATCCAGATTATGTATCTGGAAGG + Intergenic
1021715459 7:23458033-23458055 ATTCAGATGGGGAAGCTGGATGG - Intronic
1022909518 7:34887094-34887116 ATCCAGGTGCACATTGTGGAGGG - Intergenic
1023351011 7:39320231-39320253 ACGGAGATTCAGAATCTGGAAGG - Intronic
1024112912 7:46164444-46164466 ATCCTGATGAAGAAGCTGGAAGG - Intergenic
1025806443 7:64838172-64838194 ATCCAGTTGGAGGAGCTGGAGGG + Intergenic
1026351404 7:69518554-69518576 AGCCAGATGTAGATTCTGGGTGG + Intergenic
1027239452 7:76317896-76317918 ATTCAGATGGAGAAACTGAAGGG + Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1030081228 7:105780256-105780278 ATCCAGATGCTGATGCTGGTTGG - Intronic
1031324100 7:120370298-120370320 GGCCAGATGCAGATCCTGGAGGG + Intronic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1031755542 7:125637395-125637417 ATCCCATTGCAGAATCTGTAGGG - Intergenic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032997270 7:137461677-137461699 ATCCAGCTGGAGAAGCTGAAAGG + Intronic
1033250686 7:139755881-139755903 ATACAGAAGCAGTATCTGAAGGG - Intronic
1033591291 7:142810666-142810688 ATTCAGATGCTGATTCTGTAGGG - Intergenic
1034188868 7:149198516-149198538 AGCCAGCTGCTGAACCTGGAGGG + Exonic
1035742927 8:1942885-1942907 ATCCAGAGACAGAACGTGGATGG + Intronic
1036947559 8:13108869-13108891 AACCAGATGCAGTTTCGGGAGGG - Intronic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1046347732 8:112956899-112956921 ATACAGATGCAGAAGATGAAAGG + Intronic
1046645094 8:116777200-116777222 CTCTAGAGGCAGGATCTGGAAGG + Intronic
1046868032 8:119172724-119172746 ATCCAGAAGCAAGATCTTGATGG + Intronic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048790861 8:138102029-138102051 CTTCAGGTTCAGAATCTGGATGG + Intergenic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1051982182 9:23034076-23034098 ATCAATATCCAGAATATGGAAGG + Intergenic
1052116409 9:24653100-24653122 ATACAGATGAAGAAACTGGCTGG + Intergenic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1055822392 9:80282532-80282554 TTACAGATGGATAATCTGGATGG - Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1060781724 9:126418034-126418056 GGCAAGAGGCAGAATCTGGAAGG + Intronic
1187821743 X:23295218-23295240 AACCAGAGGCGGAATCTAGATGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188909603 X:35830300-35830322 ATGGAGATGAACAATCTGGATGG - Intergenic
1189150245 X:38699365-38699387 ATGCAGATTCAGATTCTGGGTGG - Intergenic
1189364212 X:40375707-40375729 ATCCAGGTGCAGCAAGTGGAGGG + Intergenic
1190421640 X:50290689-50290711 ATTCAGCTGGAGAATCAGGAGGG - Intronic
1190915869 X:54810815-54810837 ATGCAGGTGAAGCATCTGGATGG + Exonic
1194211151 X:91071175-91071197 ATCAATATCCAGAATCTGTAAGG + Intergenic
1195223370 X:102767880-102767902 ATCCGATTGGAGAATCTGGAAGG - Intergenic
1195651165 X:107286648-107286670 TTCCACATGCAGAAACAGGAAGG + Intergenic
1198686672 X:139234964-139234986 ATCCACATGATGACTCTGGAAGG - Intergenic
1202384364 Y:24310642-24310664 GTCCAGATCAAGAAGCTGGAAGG + Intergenic
1202486419 Y:25359480-25359502 GTCCAGATCAAGAAGCTGGAAGG - Intergenic