ID: 1028095615

View in Genome Browser
Species Human (GRCh38)
Location 7:86756507-86756529
Sequence TTGAAGTTCTGGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028095615 Original CRISPR TTGAAGTTCTGGGGAAAAAC TGG (reversed) Intronic
902185824 1:14724653-14724675 TTTCAGTTCTGGAGAAAAATGGG - Intronic
902925742 1:19694650-19694672 TGGAGCTTCTGGGGGAAAACAGG + Intronic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905839264 1:41160961-41160983 GTGAAATTCTGGGGTAAAATAGG + Intronic
906140105 1:43529327-43529349 TTCAAGTTCAGGACAAAAACAGG + Intronic
906457044 1:46006063-46006085 CTGAAGGGCTGGAGAAAAACAGG + Intronic
908628950 1:66080421-66080443 TTGTAGTATTGGGGAAAAAAGGG + Intronic
908720315 1:67118573-67118595 TTGAGTTTCTGGGGAAATGCTGG + Intronic
909502865 1:76354725-76354747 TAGAAGTTCTGAGGAAATACTGG - Intronic
911057323 1:93720173-93720195 TGGAACTTCAGGGGAGAAACAGG - Intronic
912793745 1:112676931-112676953 TTTTAGTACTGGGGAAAAACTGG + Intronic
917179720 1:172282980-172283002 AAGAAGTTCTGGAGTAAAACAGG - Intronic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
919114255 1:193260759-193260781 TTGAATTTCAGGGTAAAAAGAGG + Intergenic
919583668 1:199409017-199409039 TTCAAGTTCATGGGATAAACAGG - Intergenic
922013225 1:221614058-221614080 CTGCAGTTCAGAGGAAAAACTGG - Intergenic
922738963 1:228005196-228005218 TTGTGGTACTGGGGAAAACCTGG - Intergenic
923397415 1:233580900-233580922 GTGAAAATCTGAGGAAAAACAGG - Intergenic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1064177503 10:13087600-13087622 ATGGAAGTCTGGGGAAAAACAGG + Intronic
1065169835 10:23015733-23015755 TTTAAGTTATGGGTAAAAAGAGG - Intronic
1065718905 10:28605561-28605583 TTGCAGTTTTGGGGAATTACAGG - Intronic
1066411363 10:35172791-35172813 ATGACGTTCTGTGGAAAAACAGG - Intronic
1066487051 10:35856207-35856229 TTGATGTATTGGGGAAAAAAGGG - Intergenic
1067307992 10:45083453-45083475 TTGATATACTGGGGAAAAAAGGG - Intergenic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1070949041 10:80416219-80416241 CTAAAGTTCTTGGGACAAACAGG - Intronic
1073663166 10:105499997-105500019 TTAAAGTGCTGGGGAAAAAATGG - Intergenic
1073678951 10:105680690-105680712 TTGAAGTTCTTGGCAAAAATTGG - Intergenic
1073712289 10:106057355-106057377 TTCCAGTTCTGGGGAAGAAAGGG - Intergenic
1073907098 10:108295285-108295307 TTGAAGTTCAGGAAAGAAACAGG + Intergenic
1074286468 10:112102602-112102624 TTGAAGTTCCTGGGAAAAGTGGG + Intergenic
1075090900 10:119443814-119443836 TTGCTGTTCTGGGGACAGACTGG - Intronic
1078425933 11:11251419-11251441 TAGCAGTTCTGGGGAGAAGCAGG + Intergenic
1080065969 11:28013725-28013747 TTAATGTGCTGGGGAAAAACAGG + Intergenic
1080900402 11:36484401-36484423 GTTAAGTTCTGAGGAAAAGCAGG + Intergenic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1081211612 11:40342110-40342132 TTAATATTTTGGGGAAAAACTGG - Intronic
1084090239 11:66874976-66874998 GTGAAGTTCTCAGGAAGAACAGG + Intronic
1087588949 11:100159948-100159970 TTTAAGTTCTGGGGATACATAGG + Intronic
1087655079 11:100912757-100912779 TTGGAGTTTTGGGGAACAACTGG - Intronic
1087772145 11:102222467-102222489 TTGAGGTCCTGGGCAAATACAGG + Intronic
1088162207 11:106885999-106886021 TTGAATTACTGGGGAAAAGGAGG + Intronic
1088282609 11:108150798-108150820 TGAAAATTCTGGGGAAAAAATGG - Intergenic
1088841670 11:113632731-113632753 TTGAAGTTCTTGGGCAGAATGGG - Intergenic
1088909479 11:114180098-114180120 TTAAAGTTCGGTGGAAAGACAGG - Intronic
1090540331 11:127695533-127695555 TTGTACTGCTGGGGAAATACTGG + Intergenic
1090660078 11:128875857-128875879 ATGAAATTCTGGGGAAAACGTGG - Intergenic
1090768838 11:129900947-129900969 TTACATTTCTGGGTAAAAACTGG - Exonic
1091301824 11:134512796-134512818 TCCAAGTTCTGGGGAAAATAGGG - Intergenic
1091621942 12:2095596-2095618 TTGAAGGACTGGCGAAACACTGG - Intronic
1091951417 12:4596177-4596199 ATGAAGTTCTGGAGACAATCGGG + Exonic
1095168065 12:38998046-38998068 CTGAAGTTCTGGGTAAATAATGG - Intergenic
1095705344 12:45230885-45230907 TTGAACTCCTGGGGAACTACAGG - Intronic
1097197436 12:57251055-57251077 TGGTGGTGCTGGGGAAAAACTGG + Exonic
1097574216 12:61371445-61371467 TTGAGGTTCTAAGGAAAAATAGG - Intergenic
1098881804 12:75925098-75925120 CTGAAAGTCTGGGGAACAACTGG + Intergenic
1100180824 12:92084491-92084513 TTGAACTTCTGGGGAATCTCTGG + Intronic
1100757299 12:97765596-97765618 TTGAAATTCTGTGGAATAAGAGG + Intergenic
1101185036 12:102267172-102267194 CTCAAGTCCTGAGGAAAAACAGG - Intergenic
1101699926 12:107163230-107163252 TAAAAGTTCTGGGGAAGAAATGG + Intergenic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1105538793 13:21296853-21296875 TAGAAATTCTGGGGAATAAGAGG + Intergenic
1106474000 13:30081683-30081705 TTAAAATTCTGTGGAATAACTGG + Intergenic
1106700964 13:32228335-32228357 TTTAAATTCTGGGGAGAAAATGG - Intronic
1106792802 13:33172882-33172904 TTGAATTTCTATGGACAAACTGG + Intronic
1107060300 13:36153317-36153339 TTTAAGTTTTTTGGAAAAACAGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1109469678 13:62789123-62789145 TGTAACTTCTGGGGGAAAACAGG - Intergenic
1109707998 13:66124196-66124218 TAGAAGTTTTGGGGGAAGACTGG - Intergenic
1110380128 13:74840891-74840913 TTGAAGGCATGGGGATAAACTGG - Intergenic
1110911030 13:80963730-80963752 TTCCAGTTCTGGGGAAACAAGGG - Intergenic
1111697625 13:91644972-91644994 TTGAAGTTCAGTGGAATACCAGG + Intronic
1112603039 13:100875769-100875791 TTGAACTTCTTGGGCAAACCAGG - Intergenic
1115548357 14:34483176-34483198 TTGAAGTTCTGAGAAAAACAAGG + Intergenic
1115919193 14:38354074-38354096 TTTAAGTTCTAGGGCAAGACTGG - Intergenic
1116173695 14:41436952-41436974 TTGAAGTTATGCAGAAGAACAGG + Intergenic
1117142085 14:52799320-52799342 TCAAAGTTATGGTGAAAAACAGG + Intergenic
1118113503 14:62749373-62749395 TTAAACTTCTGGGAATAAACAGG - Intronic
1118690258 14:68331823-68331845 TTCAAGTTGCAGGGAAAAACTGG + Intronic
1118898726 14:69968960-69968982 TTGAAGTTCTGAGGCAATTCAGG + Intronic
1119574126 14:75702921-75702943 TTCCAGTTTTGGGGTAAAACAGG - Intronic
1119979169 14:79059965-79059987 TTGCAGGTTTGGGGAAACACAGG + Intronic
1119979566 14:79064223-79064245 TTGTAGTTCTGTGGAGAAATCGG - Intronic
1120488319 14:85144230-85144252 TTGAAGTTCTTTGAAAAAAATGG - Intergenic
1120511541 14:85421661-85421683 CTGTAGTACTGGGGAAAAAAGGG + Intergenic
1120643958 14:87049891-87049913 TTTAAGTACTGGAGAGAAACTGG - Intergenic
1121590459 14:95102690-95102712 TTCAAGTTATGGGGGAAAAATGG - Intronic
1121727958 14:96166670-96166692 TTGAAGGTCTGGGGAGAAGGTGG - Intergenic
1121873545 14:97430805-97430827 TTGTTATTCTGGGGACAAACTGG - Intergenic
1124362418 15:29047359-29047381 TTGTAGTCATGGTGAAAAACGGG + Intronic
1125443323 15:39726604-39726626 TTCAAGTCTTGGAGAAAAACTGG + Exonic
1126477043 15:49076592-49076614 TTTGAGTTCTGGGGAAAATTAGG - Intergenic
1127102659 15:55583305-55583327 TAGAAGGACAGGGGAAAAACTGG - Intronic
1127354302 15:58183319-58183341 CTATAGTTCTGGGGAAAAGCAGG - Intronic
1127593486 15:60452520-60452542 TTTAAGGTCTGAGGGAAAACAGG + Intronic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1131846810 15:96497120-96497142 TTGGAGTTGAGGGGAAAATCAGG + Intergenic
1131957984 15:97758140-97758162 TAAGAGTTCTAGGGAAAAACCGG - Intergenic
1135943728 16:26845290-26845312 ATGAAGTGCTGGGGAACAAAAGG - Intergenic
1136451277 16:30355540-30355562 TAGAGGCTCTGGAGAAAAACTGG + Intergenic
1137461812 16:48671433-48671455 ATGAAGTTATGGGAAAAAAGAGG - Intergenic
1137788782 16:51156837-51156859 TGGAAGTTCTGCTGAAAAAGTGG - Intergenic
1138027667 16:53535312-53535334 TTGAGAGTCTGGGGAAACACAGG - Intergenic
1138686422 16:58730145-58730167 TTGAAACTCTGGGGGAAAGCAGG + Intronic
1138698054 16:58834121-58834143 TTGAAATTTTGAGGAAAAAAAGG - Intergenic
1139162483 16:64527858-64527880 GTGGAGTTCTGTGGAAAAGCAGG - Intergenic
1139666112 16:68457848-68457870 TTGAAGTGCAGGTCAAAAACTGG - Intergenic
1141007049 16:80362357-80362379 TTTGAGTTCAGGGGAAAAAGAGG - Intergenic
1142942559 17:3394909-3394931 TGGAAGTTCTGGAGAAAGGCTGG + Intergenic
1144382462 17:14716056-14716078 TGGATGTGCTGGAGAAAAACAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145786821 17:27598957-27598979 TTGAACTTCAGGGGTAAACCTGG + Intronic
1146253102 17:31367654-31367676 TTTAATTTCTGAGGAAACACTGG - Intronic
1147515436 17:41113490-41113512 TTCCAATTCTGGGGAAAATCAGG - Intergenic
1148358850 17:46995508-46995530 GTGCAATTCTGGGGAAAAAAAGG + Intronic
1149165088 17:53741757-53741779 TTGGAGTTATGGGGGAAAAAAGG + Intergenic
1152158656 17:78652812-78652834 TTGATGTACTGGGGAAGAAGAGG - Intergenic
1152305495 17:79518078-79518100 TTGCAGTCCTGGGGAAAAGGAGG - Intergenic
1155195686 18:23471902-23471924 CTGAAGTTCTAGGGAAAGTCAGG + Intronic
1155703276 18:28776471-28776493 TTGAAGCTCTGGGGATCAAGAGG + Intergenic
1156194861 18:34762963-34762985 TTGAAGTCCTGGGGGAAATACGG - Intronic
1156244061 18:35280858-35280880 TTCCAGTTCTGGGGAAAAAAAGG - Intronic
1156760154 18:40579435-40579457 TTGAAGTGCTCGGGCAAAAATGG - Intergenic
1157666290 18:49489917-49489939 TTGAAGGTCTGGGCCAGAACTGG - Intronic
1161497154 19:4592923-4592945 TTGAGTTTCTTGGGGAAAACTGG + Intergenic
1164918495 19:32071081-32071103 GAGAAGGTCTGGGGAAAATCCGG + Intergenic
1165137407 19:33678323-33678345 TGGATGCTCTGTGGAAAAACAGG - Intronic
1165384026 19:35500022-35500044 TTGTAGTTCTGTGGAAGAAGTGG + Exonic
1165554408 19:36617622-36617644 TTGAAGTACTGGGGAGAGAATGG + Intronic
1165966038 19:39581701-39581723 TAGAGGTTCTGGGGGAACACTGG - Intergenic
1166476706 19:43132924-43132946 AAGATGTCCTGGGGAAAAACTGG + Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167191396 19:47992292-47992314 TTGAAGTTCTGAGGAACAAGTGG + Intergenic
1167724376 19:51200569-51200591 GGGAAGTACTGGGGAAATACAGG - Intergenic
1168253114 19:55152132-55152154 AGGAAGTGCTGGGGAAAGACAGG - Intronic
926594554 2:14776161-14776183 TAAAAGTTCTAGGGAAAAAATGG + Intergenic
926832157 2:16975707-16975729 TAGAAGTTCTGTGAAAAGACTGG + Intergenic
927068791 2:19503290-19503312 TTGTAGTTCTGGGAAAAAAGTGG + Intergenic
928284680 2:29979528-29979550 TTCAAGTTCTGGAGAAGAAAAGG - Intergenic
928361324 2:30664428-30664450 TTGAGGTTCTGGGCAGAGACTGG + Intergenic
928636732 2:33254333-33254355 TTTAAGTTCAGGGGTAAAAGTGG + Intronic
929271325 2:39975465-39975487 ATGGAGATCTGGGGAAACACGGG - Intergenic
929472281 2:42206384-42206406 TTGAATTTCTGGGGGAGAAATGG + Intronic
930611715 2:53552260-53552282 ATGAAGTAATGGGGAAAAAATGG + Intronic
931088086 2:58856286-58856308 ATGAAGTTCTAGGGAAAGACAGG + Intergenic
931493717 2:62778906-62778928 TTCAATGTCTGGGGAAAGACTGG + Intronic
931974842 2:67631849-67631871 TTGAATTAATGGGGAAAAAAAGG - Intergenic
937165057 2:119805942-119805964 ATGAAATTCTGGGGTAAAAGAGG - Intronic
937681451 2:124648894-124648916 TTGAAAGGCTGGGGAAAAAATGG + Intronic
937787434 2:125918664-125918686 TTCAAGTTCGTGGGAAAAAAGGG + Intergenic
939011861 2:136855910-136855932 GTGAAGATCTGGGGAAAAGGAGG - Intronic
939583126 2:143975326-143975348 ATGAAGTTATGTGGAAAAATAGG - Intronic
940460180 2:153955201-153955223 ATTAAGCTTTGGGGAAAAACTGG - Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
942693775 2:178615554-178615576 TTGAAGTTATGGGGCAAGGCAGG - Intronic
942810259 2:179991284-179991306 GTGAGGTTCAAGGGAAAAACAGG + Intronic
942923348 2:181403728-181403750 TGGAAGTTCTGGGGAAAAGAAGG + Intergenic
943339754 2:186665828-186665850 TTGAAGATCTGTGGTAATACAGG + Intronic
944130261 2:196340023-196340045 TTAAAGTTCCAGGGAAAACCTGG - Intronic
946058492 2:216921120-216921142 ATGAGGTTCTGGGGAAGAATGGG + Intergenic
946086346 2:217177101-217177123 TTGTAGTCCTGGAAAAAAACAGG + Intergenic
946508671 2:220330218-220330240 TTGAATTTCAGTGGCAAAACTGG + Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
948515939 2:238504028-238504050 ATGAAGATCTGTGGACAAACTGG - Intergenic
948705789 2:239791837-239791859 TTGAAGCACTGTGGAAAATCCGG + Intronic
1170296179 20:14828899-14828921 TTGTAGTTGTGGGCAAAAAGGGG - Intronic
1170297010 20:14838858-14838880 TTGAAGTTCTGGGGAGTGAAGGG - Intronic
1173129330 20:40374085-40374107 TTAAAATTCTGGGGAAAACTGGG - Intergenic
1174249698 20:49209293-49209315 TTCAAGGTATGGGGAAGAACTGG + Intergenic
1174894990 20:54439035-54439057 TTGCATCTCTGGGGAGAAACAGG - Intergenic
1179606654 21:42520585-42520607 TGAAAGTTCTCGGGATAAACTGG + Intronic
1181944185 22:26503018-26503040 TTGAATTTATGGGGGAAAGCAGG - Intronic
1182083565 22:27545758-27545780 TTGTGGTGCTGGGGAAAAACAGG - Intergenic
1182999683 22:34844749-34844771 TTGAAGTTTTGGGTTAATACTGG + Intergenic
1183092226 22:35530338-35530360 ATGAAGTTCCAGGAAAAAACCGG - Intergenic
1183113053 22:35667208-35667230 TTGAGGTTCTGAGGTAAACCTGG - Exonic
950980038 3:17293241-17293263 TTGAATTTCTGGAGAAAAAAAGG - Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
955940641 3:64144150-64144172 TTTAACTTCTCTGGAAAAACTGG + Intronic
957764858 3:84610401-84610423 TCTAGGTTCTGGGGAAAAAGAGG - Intergenic
959440269 3:106365760-106365782 TGGTAGTTCTGGAGACAAACTGG + Intergenic
961295559 3:125881407-125881429 TTCAAGTTCTGGTGAAAAGACGG + Intergenic
962133010 3:132702438-132702460 TTGAGTTTCTGGGGAAAACTTGG - Intronic
965103233 3:164329431-164329453 TAAAAGTTCTTTGGAAAAACTGG - Intergenic
965465230 3:169021286-169021308 TTTAAGTCCTAGGGGAAAACTGG + Intergenic
965648396 3:170908520-170908542 GTGAAGACCTGGGGAAAAGCTGG - Intronic
967415175 3:189209040-189209062 TTTAACTTATGAGGAAAAACTGG + Intronic
968040937 3:195588790-195588812 GTGAAGTTTGGGGGAAAATCAGG + Intergenic
971062157 4:22984426-22984448 TTGAAGTTCTTGAGAAAGAATGG + Intergenic
972975137 4:44624918-44624940 TGGAAGTTCTGGGAAAAACATGG + Intronic
974509883 4:62825285-62825307 TTGATGTTCAGAGGAATAACAGG + Intergenic
975221278 4:71814910-71814932 CTGAGCTTGTGGGGAAAAACAGG + Intergenic
975326586 4:73065419-73065441 TTGAGGTTAGGGGGAAAAAAGGG + Intronic
976701732 4:87977076-87977098 TGGAAGTTCTGAGGAAAAGCAGG + Exonic
977319836 4:95499620-95499642 GTGAAGTTGTGGGGAGAAAAAGG + Intronic
983476870 4:168223133-168223155 TTGATGGCCTGGGGGAAAACGGG + Intronic
984355107 4:178647900-178647922 TTGAATATCAGGGGAAAAAGTGG + Intergenic
984810186 4:183789252-183789274 TAGAAGTTCTGTGGAAATTCTGG + Intergenic
987192623 5:15493905-15493927 TCCAAGCTCTGGGGAAAAAGTGG - Intergenic
987875069 5:23671340-23671362 TTGAAGGTCTAGAGAAAAAGAGG + Intergenic
988032193 5:25777516-25777538 TTAAAGTTCTGGGAAAAGGCCGG - Intergenic
988776774 5:34484151-34484173 TTAAAGTTCTGGGGAAAAATTGG - Intergenic
989707777 5:44358278-44358300 TTGAAATTCTGGGTAAACATTGG + Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
992624375 5:78623976-78623998 TTGTTATTCTGGGGAAAACCAGG - Intronic
993318560 5:86442953-86442975 TTGAATCTCTGGGGCAAAAGTGG - Intergenic
993690166 5:90990197-90990219 TTGATGCTTTGAGGAAAAACAGG - Intronic
994526601 5:100913634-100913656 TTTATTTTCTGGGGAATAACAGG + Intergenic
997240428 5:132302524-132302546 TGGACGTTCTGGGGAAAGGCTGG + Intronic
998236650 5:140403387-140403409 TTTGGGTTCTGGGGAAAAAGGGG + Intronic
998960430 5:147480583-147480605 TTAAACTTCTGTGGAAAACCTGG - Intronic
1000319482 5:160122756-160122778 TTGAAGTTCTGAGGCAAAAGAGG + Intergenic
1002110250 5:176904293-176904315 TTGAAGTTGTAATGAAAAACTGG - Intergenic
1003031998 6:2609471-2609493 ATTAAGTTTTGGGGAAAAGCAGG + Intergenic
1003591895 6:7443719-7443741 TTGAGGATCTTGGGACAAACAGG + Intergenic
1003609714 6:7600126-7600148 TTGAATTAATGGGGAAAAAAGGG - Intronic
1003740534 6:8933224-8933246 TTAAAGTTTTGGAGAAGAACGGG + Intergenic
1007128041 6:39443899-39443921 TTCATGTTTTGGGGAAAAAAAGG + Intronic
1008629944 6:53354029-53354051 TCGAAGTGCTGGGGAAACAGTGG - Intergenic
1009331387 6:62425115-62425137 TTTAAGTTCTGGGGATACATGGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009815745 6:68732533-68732555 TTGAAGATATGGTGAGAAACAGG + Intronic
1009891695 6:69691963-69691985 TTTAAGTTCTGGAGTAAAAAAGG - Intronic
1011811781 6:91140487-91140509 TAAATGTTATGGGGAAAAACGGG + Intergenic
1013749922 6:113392934-113392956 TTGAAGTGCTGGTGAAAAACAGG + Intergenic
1014943368 6:127469619-127469641 TTGAAGTTATAGGGAAAAGATGG + Intronic
1015024284 6:128514799-128514821 TTGAGGTTCTGGGAAAACACTGG - Intronic
1015435701 6:133184496-133184518 TTGAAGTTCTGGAAAACAAGAGG - Intergenic
1015796530 6:137017523-137017545 TTAAATTTCTGGGGATTAACTGG - Intronic
1016322100 6:142857639-142857661 CTGAAGTTTTGGAGAAAAACAGG - Intronic
1017157668 6:151336943-151336965 CAGAAGTTCTGGGGACAGACTGG - Intronic
1017927227 6:158921140-158921162 TTGAAGCTCTCAGGAGAAACAGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020409962 7:7881158-7881180 TTAAAGTTTTTGGGAAATACAGG + Intronic
1021301723 7:18981520-18981542 TGGAGGCTCTGGGGAAAAATTGG + Intronic
1021414096 7:20362043-20362065 TTGAGTGTCTGGGGAAATACAGG + Intronic
1021680951 7:23131295-23131317 TTCAAGTTCCTGGGAAAAAAGGG - Intronic
1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG + Intronic
1023491147 7:40743592-40743614 GTTAAGTGCTGAGGAAAAACTGG - Intronic
1024293133 7:47820837-47820859 TTTAAGTTCTGTGCCAAAACAGG - Intronic
1024396991 7:48880861-48880883 TAGAAGTGCCAGGGAAAAACAGG - Intergenic
1025741373 7:64199375-64199397 TCCAAATTCTGGAGAAAAACAGG + Intronic
1027880505 7:83829424-83829446 TTGAAGTTCTGGGGTACATGTGG + Intergenic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1029891781 7:103937578-103937600 ATGAAATGATGGGGAAAAACTGG + Intronic
1034837189 7:154363346-154363368 TTGAAGCACTGGGGACAAACTGG - Intronic
1034856141 7:154549033-154549055 TGGAAGGTCTGGGGAAAAGGTGG + Intronic
1035434759 7:158850874-158850896 TTAGAGTCCTGGGGAAAAAGAGG - Intergenic
1036811971 8:11873257-11873279 TGGAAACTCTGGAGAAAAACGGG + Intergenic
1037955483 8:23054432-23054454 TCGAAATTCTGGAGAAAATCAGG - Intronic
1038535844 8:28352309-28352331 TTTTAGTTCTGGGTAGAAACGGG - Intronic
1038550431 8:28463523-28463545 TAGAAGTTAAGGGGAAACACAGG - Intronic
1039375242 8:37026357-37026379 TTGAAGTTTTATGGAAATACAGG - Intergenic
1040532074 8:48274317-48274339 TTGAAAGTGTGGGGAAAATCTGG - Intergenic
1041443394 8:57923966-57923988 TTGGAGTTCGGGGAAAATACAGG - Intergenic
1042638914 8:70910779-70910801 TGGAGGTTCTGAGGAAGAACTGG + Intergenic
1043496368 8:80805231-80805253 TAGAAGTGCTAGGGAAAAGCAGG - Intronic
1043506129 8:80904826-80904848 TTGAAGTTCTGGGGAAGGGGAGG - Intergenic
1044266518 8:90188526-90188548 CTGAAATTCTTGGAAAAAACAGG + Intergenic
1048664010 8:136640983-136641005 TGGAAGTTCAGGGGAATCACAGG - Intergenic
1050280197 9:4042540-4042562 TAGAAGATTTGGGGTAAAACAGG - Intronic
1051824356 9:21202386-21202408 TTTGAGTGCAGGGGAAAAACAGG - Intergenic
1052158386 9:25224639-25224661 TTGAAATTATGGGAATAAACCGG - Intergenic
1053606865 9:39668757-39668779 TTGAAGAAATGGGGAAACACAGG - Intergenic
1053864782 9:42425381-42425403 TTGAAGAAATGGGGAAACACAGG - Intergenic
1054246670 9:62673645-62673667 TTGAAGAAATGGGGAAACACAGG + Intergenic
1054560792 9:66708179-66708201 TTGAAGAAATGGGGAAACACAGG + Intergenic
1055876418 9:80947635-80947657 TTTAAGTTCTCATGAAAAACAGG - Intergenic
1057556562 9:96093011-96093033 ATGAAGTCCTGTGGAAAAAAAGG - Intergenic
1057619351 9:96620765-96620787 TTCAAGTGCTGGTGAAAAATAGG - Intergenic
1058399438 9:104597048-104597070 TGGAGGTTCTGGGGAAATTCTGG - Intergenic
1059459179 9:114418947-114418969 TTGAGGTTCTGGGGATACAGTGG - Intronic
1059803339 9:117772987-117773009 AGGAAATTCTGGGGAAAAAATGG + Intergenic
1059833628 9:118126433-118126455 TTGAAGTTTTGGGATCAAACTGG + Intergenic
1060690124 9:125650364-125650386 GTGAAGCTCTGGGGGAAGACCGG - Intronic
1186186754 X:7028521-7028543 AAGATGTTCTGGGGAAAAACTGG + Intergenic
1190414998 X:50172313-50172335 TTGGAGTTCAGAGGAAAGACTGG - Intergenic
1190442757 X:50492243-50492265 TTGGAGCTCTGGGGAGAAGCTGG + Intergenic
1190566663 X:51737447-51737469 TTGAAGTTTGAGGGAAAAAAAGG - Intergenic
1190580765 X:51891924-51891946 AGGAAGTGCTGAGGAAAAACAGG + Intronic
1191844423 X:65535838-65535860 TTGGAGTTCTGGGAGAAAAGCGG + Intergenic
1192577275 X:72253080-72253102 TTGTAGAGCTGGGGAAAACCAGG - Intronic
1193918026 X:87390956-87390978 TAGAAGTACAGGGGAAAAAAGGG - Intergenic
1196458243 X:115904804-115904826 GTGAAGTTCTGGAGACAAAAAGG - Intergenic
1197264579 X:124354805-124354827 TGGAAGTTCAGGGGAAGAAGTGG + Intronic
1198403909 X:136293502-136293524 TTGAAGTTTTGAGGAGGAACAGG + Intergenic
1198526693 X:137508596-137508618 TTGCAGTGGGGGGGAAAAACAGG + Intergenic
1201752726 Y:17450990-17451012 ATCAAGTTCTGGGAAAAAAATGG - Intergenic
1201793061 Y:17863477-17863499 TTCAACTACTGCGGAAAAACAGG + Intergenic
1201808493 Y:18042509-18042531 TTCAACTACTGCGGAAAAACAGG - Intergenic
1202354593 Y:24032721-24032743 TTCAACTACTGCGGAAAAACAGG + Intergenic
1202516185 Y:25637391-25637413 TTCAACTACTGCGGAAAAACAGG - Intergenic