ID: 1028101266

View in Genome Browser
Species Human (GRCh38)
Location 7:86823808-86823830
Sequence CTAGATCCCTAGTGTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028101264_1028101266 5 Left 1028101264 7:86823780-86823802 CCTTAAAAAGACTTCTCTGATAT 0: 1
1: 0
2: 2
3: 20
4: 317
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101257_1028101266 27 Left 1028101257 7:86823758-86823780 CCTGATCTTTCCCACCACCCTCC 0: 1
1: 0
2: 5
3: 35
4: 471
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101263_1028101266 6 Left 1028101263 7:86823779-86823801 CCCTTAAAAAGACTTCTCTGATA 0: 1
1: 0
2: 0
3: 39
4: 409
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101259_1028101266 16 Left 1028101259 7:86823769-86823791 CCACCACCCTCCCTTAAAAAGAC 0: 1
1: 0
2: 0
3: 33
4: 319
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101260_1028101266 13 Left 1028101260 7:86823772-86823794 CCACCCTCCCTTAAAAAGACTTC 0: 1
1: 0
2: 0
3: 20
4: 245
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101258_1028101266 17 Left 1028101258 7:86823768-86823790 CCCACCACCCTCCCTTAAAAAGA 0: 1
1: 0
2: 4
3: 28
4: 316
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101262_1028101266 9 Left 1028101262 7:86823776-86823798 CCTCCCTTAAAAAGACTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 234
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1028101261_1028101266 10 Left 1028101261 7:86823775-86823797 CCCTCCCTTAAAAAGACTTCTCT 0: 1
1: 0
2: 4
3: 24
4: 353
Right 1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028101266 Original CRISPR CTAGATCCCTAGTGTAGGCC AGG Intronic
902408970 1:16201970-16201992 ATGGGTCCCTAGGGTAGGCCTGG - Intronic
904311043 1:29629834-29629856 CTGGATCCCCAGTGAAGCCCTGG + Intergenic
906930220 1:50162417-50162439 TTAAATACCTACTGTAGGCCAGG + Intronic
907410161 1:54278280-54278302 CTAGGTCCTTAGTATATGCCAGG + Intronic
911181398 1:94863584-94863606 CTAGAAGAGTAGTGTAGGCCAGG - Intronic
921906195 1:220497749-220497771 CTTGTTTCCTATTGTAGGCCTGG + Intergenic
922566197 1:226603301-226603323 CTAGATCCCTAATGGGGGCTAGG + Exonic
924076171 1:240339448-240339470 CTAGATCCCCAGTGGATGCTTGG - Intronic
1068061021 10:52067907-52067929 CAAGATCCCTACTTGAGGCCGGG + Intronic
1068736346 10:60417424-60417446 CTAGTTTACTAGTGCAGGCCTGG + Intronic
1070757544 10:79002753-79002775 CCAAACCCCTACTGTAGGCCAGG - Intergenic
1071171312 10:82868087-82868109 CTAGATCCCCAGTGTAGCCATGG + Intronic
1072316633 10:94210029-94210051 CTAGATGCGTAGGGTAGGCCAGG - Intronic
1073629507 10:105134463-105134485 TTAGATATCTAGTGAAGGCCCGG + Intronic
1077617080 11:3683831-3683853 CAAGACCCATAGTTTAGGCCAGG - Intronic
1078389633 11:10925699-10925721 GTTGATACCTACTGTAGGCCAGG - Intergenic
1079556913 11:21770449-21770471 TTAGATCACTAATGTATGCCAGG - Intergenic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1099141030 12:78975399-78975421 CTAAATGCCTAGTCTATGCCAGG - Intronic
1115179352 14:30604309-30604331 ACAGTGCCCTAGTGTAGGCCAGG - Intronic
1117760920 14:59027573-59027595 CTAAATCATTAGTATAGGCCGGG + Intergenic
1125460835 15:39905149-39905171 CAAAATCCCTAGTGCAGGCCTGG - Intronic
1128126373 15:65196040-65196062 CTAGAAACCCAGTGTAGCCCAGG - Exonic
1130095341 15:80851394-80851416 CTGAATCCCTATTCTAGGCCAGG + Intronic
1139469355 16:67170087-67170109 CTAGCTCCCTTGCTTAGGCCCGG + Intergenic
1142782399 17:2191395-2191417 ATATATCCCTAGTGTTGGGCTGG + Intronic
1144272227 17:13629338-13629360 CAAGAATCCTAGTGGAGGCCGGG + Intergenic
1144278218 17:13698053-13698075 CTCGATCTCTAGCATAGGCCAGG + Intergenic
1146905103 17:36613140-36613162 CCAGATCCCTGCTGCAGGCCTGG + Intergenic
1150559432 17:66281974-66281996 CTGGAGCCCTAGTGTTGTCCAGG + Intergenic
1150837407 17:68576863-68576885 CTAGTTGCCTAGGGCAGGCCAGG + Intronic
1152514853 17:80817263-80817285 CTGGCTCCCAAGTTTAGGCCTGG + Intronic
1153052473 18:912684-912706 TTAGATCCCTATTTTAGGCTGGG - Intergenic
1161696151 19:5769465-5769487 CTGGATCCCTAGTGTTGGAGTGG - Intronic
926238132 2:11065119-11065141 ATAGATGTCTAGTGTAAGCCAGG - Intergenic
926954231 2:18276607-18276629 CTCGATCCCTAGTGTAAACATGG + Intronic
928734788 2:34275598-34275620 CTGGATGCCTACTTTAGGCCAGG - Intergenic
935214153 2:100963057-100963079 CTAGTTCCCTAGTGTGGCCCAGG - Intronic
936791927 2:116161618-116161640 CTGGATCCCCAGTGTTGCCCAGG + Intergenic
937877524 2:126836805-126836827 CTACTCCCCTAGCGTAGGCCTGG - Intergenic
948654287 2:239466937-239466959 CTGGATCCCTAGGGTCTGCCCGG - Intergenic
1170821799 20:19760402-19760424 CTTGACCTCTAGTGTAGGGCAGG + Intergenic
1171345601 20:24463967-24463989 CTAGATCTCTAATGTAGACTTGG + Intergenic
1181885839 22:26021870-26021892 CTAGATACCTACTGTGCGCCAGG - Intronic
1182675605 22:32036708-32036730 CAAGATTCTTAGTTTAGGCCGGG - Intergenic
1183456867 22:37927622-37927644 CTAGTTCCCCAGAGGAGGCCAGG - Exonic
953699960 3:45187823-45187845 CTGCATCCCTAGAGTAGGTCTGG + Intergenic
954533494 3:51340781-51340803 CTAGACCCAGAGTGAAGGCCTGG - Intronic
955987406 3:64588376-64588398 CTAAGTGCCTATTGTAGGCCAGG - Intronic
959601302 3:108189333-108189355 CTAGATTCCTAGAGCAGTCCCGG - Intronic
970867998 4:20781303-20781325 TTAAATCCCTACTGTAAGCCAGG + Intronic
976629613 4:87222877-87222899 CTAAATACATATTGTAGGCCGGG - Intronic
977740551 4:100476011-100476033 CTAAATGCCTAGTGTATGCCAGG - Intronic
978347006 4:107781604-107781626 CTGGGTCCCTATTGTATGCCAGG + Intergenic
983765946 4:171483868-171483890 CTTGAGCCCCAGTATAGGCCAGG + Intergenic
984685221 4:182659480-182659502 CAAGATCCCCAGTGGATGCCTGG - Intronic
985800809 5:2004543-2004565 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
985800862 5:2004746-2004768 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
985800896 5:2004869-2004891 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
985800938 5:2005034-2005056 CTAGAGCCCTTGTGTGGGACAGG + Intergenic
985800969 5:2005156-2005178 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
986344817 5:6824529-6824551 CTAGATCCATAGTTTACACCAGG - Intergenic
987310915 5:16680244-16680266 CTAGATACCTAGTGCAGGGCAGG - Intronic
991777940 5:70103678-70103700 CTTAATCCCTAATATAGGCCGGG - Intergenic
991857227 5:70979134-70979156 CTTAATCCCTAATATAGGCCGGG - Intronic
991870387 5:71104003-71104025 CTTAATCCCTAATATAGGCCGGG - Intergenic
996064626 5:119067407-119067429 CTAAATCCCTATTCTTGGCCGGG - Intronic
1003621826 6:7707517-7707539 CTGGGTCCCAAGTGTAGGCCTGG - Intergenic
1004908721 6:20261116-20261138 CTAGATGCATGGTGTAGGCGGGG - Intergenic
1007461320 6:42021291-42021313 ACAGATCCCTAGTGGATGCCTGG - Intronic
1013366907 6:109443704-109443726 CTGGACCCCCAGTGTAGGGCTGG + Exonic
1019645170 7:2125045-2125067 CCGGATCCTTAGTGTGGGCCGGG - Intronic
1024643158 7:51348488-51348510 CTAGCCCCTTAGTGCAGGCCGGG + Intergenic
1027775776 7:82462993-82463015 TAAGAGCCCTAGTGTTGGCCTGG + Intergenic
1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG + Intronic
1028291474 7:89070673-89070695 CTAAATTCTTACTGTAGGCCAGG - Intronic
1031220288 7:118956952-118956974 CTAGATCTCAAGTGAGGGCCCGG + Intergenic
1032291908 7:130596554-130596576 CTGGAGCCCTAGTGTTGCCCAGG - Intronic
1033777935 7:144633878-144633900 CAAGATCCCTAGTGGGTGCCTGG - Intronic
1035790078 8:2296672-2296694 CTAAAACCCAAGTATAGGCCGGG + Intergenic
1035802727 8:2425033-2425055 CTAAAACCCAAGTATAGGCCGGG - Intergenic
1037184671 8:16048158-16048180 TTGGATCCCTACTGTATGCCTGG - Intergenic
1037323519 8:17665963-17665985 CTAGAACCTTAGGGGAGGCCCGG - Intronic
1041788525 8:61663538-61663560 CTAGATCCCAAGTCTAGACCTGG - Intronic
1041925937 8:63236399-63236421 ATAGATCCCTATTGTAGACCTGG - Intergenic
1043605415 8:81992705-81992727 ATAGATAACTAGTATAGGCCTGG - Intergenic
1045980386 8:108179869-108179891 CCAGATACATAGTGTAAGCCAGG + Intergenic
1047531989 8:125685342-125685364 ATAGATCCCTGGAGTAGGCAAGG - Intergenic
1052253745 9:26428917-26428939 CTAGATCTCTAGTGAAGCCAGGG - Intergenic
1054860710 9:69949984-69950006 CTGGATCCGTAGTTTAGGTCAGG + Intergenic
1057994068 9:99803844-99803866 CTAGATCCCCAGTGTAGTTCCGG - Intergenic
1059357221 9:113709358-113709380 CTAGCTCCCTAGCAGAGGCCGGG - Intergenic
1186746083 X:12570695-12570717 CAAGACCCCTAGTGGATGCCTGG + Intronic
1192549551 X:72043000-72043022 CTACATACCTAGTCCAGGCCTGG - Intergenic
1198659195 X:138948388-138948410 CTAAATCCCTACTTTTGGCCAGG + Intronic
1200167284 X:154045516-154045538 CAAGATCCCAACTGGAGGCCGGG + Intronic