ID: 1028103614

View in Genome Browser
Species Human (GRCh38)
Location 7:86851190-86851212
Sequence GAACACACCTTGGAAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 9, 3: 40, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028103614 Original CRISPR GAACACACCTTGGAAAATGC TGG Intronic
900565022 1:3327955-3327977 GCAAACAAGTTGGAAAATGCTGG + Intronic
905786584 1:40762887-40762909 GACCACACCTGTGACAATGCAGG + Exonic
905910887 1:41653509-41653531 AAACACACCATGGGAAAAGCTGG + Intronic
908359913 1:63358821-63358843 AAACACACTTTTGGAAATGCTGG - Intergenic
908688308 1:66748751-66748773 GAACACAATTTGTAAAATACTGG - Intergenic
908954759 1:69609864-69609886 GAATACAGCTTATAAAATGCCGG - Intronic
909281130 1:73755205-73755227 GAACTCACTTTGGAATATTCTGG + Intergenic
912988813 1:114462440-114462462 AAAAACACTTTGGAAAATTCTGG + Intronic
914224817 1:145711752-145711774 GACCAGACCTTGGTACATGCAGG - Intergenic
914517576 1:148387370-148387392 AAACATACCCTGGGAAATGCTGG + Intergenic
914957223 1:152173621-152173643 GAACACAGTTTGAAAAATACTGG - Intergenic
916295838 1:163218815-163218837 GAACACTTCTTAGGAAATGCTGG - Intronic
916837994 1:168568793-168568815 TAAAACACTTTGGGAAATGCTGG + Intergenic
916944139 1:169707907-169707929 AAACATCACTTGGAAAATGCTGG + Intronic
917577205 1:176336134-176336156 GAGCAAACCTTGGAAAGGGCAGG + Intergenic
917637196 1:176948867-176948889 AAACACAACTTGGAAAATGCTGG + Intronic
918184222 1:182112918-182112940 GAACAAACATTGGCAAATGCTGG - Intergenic
923223185 1:231914792-231914814 GATCACATCTTGCAAAATGTAGG - Intronic
923349427 1:233089143-233089165 AAAGACACATTGTAAAATGCTGG + Intronic
923834187 1:237591499-237591521 GGACACACCTTGGACATTGAAGG + Intronic
924401004 1:243681888-243681910 TAAAACACCTTGTAAAAAGCAGG + Intronic
1063682835 10:8206637-8206659 GACCACACTTTGGGAACTGCTGG + Intergenic
1064005805 10:11698033-11698055 GAGCAATCCTTTGAAAATGCAGG + Intergenic
1065616271 10:27527992-27528014 GAAAACAATTTGGAAAATGTTGG + Intronic
1066233572 10:33463188-33463210 GAACACACGCTAGGAAATGCTGG + Intergenic
1068544577 10:58331433-58331455 TATCACACTTTGGAAAATGCTGG - Intergenic
1069369319 10:67729398-67729420 GTACAGAACTTTGAAAATGCAGG - Intergenic
1071276754 10:84062396-84062418 GAAGTCACCTGGGAAACTGCTGG + Intergenic
1071775315 10:88780375-88780397 GGCCAGACCTTGGAAAATGTGGG - Intergenic
1072035497 10:91559593-91559615 CCAAACACTTTGGAAAATGCCGG + Intergenic
1072442494 10:95469412-95469434 GAACACATTTTGGGAAATGTTGG - Intronic
1072483979 10:95836772-95836794 GAACATGCATTGGAAAATGCTGG + Intronic
1074329286 10:112488135-112488157 GTACAAACATTGGAGAATGCAGG - Intronic
1075632462 10:124009210-124009232 GAACACTTCTTGGAAAATCTAGG - Exonic
1077965148 11:7122669-7122691 GAACAAACCCTGGATACTGCAGG + Intergenic
1077997831 11:7469161-7469183 GATCAGACCTTGGGAAAAGCTGG + Intergenic
1080178428 11:29394518-29394540 GAACACTCCTTGAATAATGCAGG + Intergenic
1081268636 11:41057901-41057923 GAACACTCCTTGGAACACCCTGG + Intronic
1081289785 11:41309770-41309792 GAATGCACCTAGGAAAATACAGG + Intronic
1081586011 11:44384414-44384436 GAACCCATTTTGAAAAATGCTGG + Intergenic
1081763525 11:45593421-45593443 GAGCACAGCTTTGAAACTGCTGG - Intergenic
1081823571 11:46024038-46024060 GAACACAGTTTGGGAAATACTGG + Intronic
1082790747 11:57345288-57345310 GAGCACACTTTTGGAAATGCTGG - Intronic
1083010825 11:59397283-59397305 GATCCCTCCTAGGAAAATGCTGG + Intergenic
1084358598 11:68655138-68655160 GTACACACATTCGAAAATACCGG - Intergenic
1084518594 11:69649521-69649543 GAACACGCCCTAGAAAATGCAGG - Intronic
1084555550 11:69873835-69873857 GAATACAGCTGGGAATATGCTGG - Intergenic
1084595927 11:70117044-70117066 GAACACACTTTGGGAAACACTGG + Intronic
1087790377 11:102400199-102400221 GAACACATTTTGGGAAATGTTGG - Intronic
1088499773 11:110472108-110472130 GAAGACACCTTGGAAAAGGAAGG - Intergenic
1089518893 11:119050964-119050986 GAACCCACTTTGGAAATGGCTGG + Intronic
1089778828 11:120858701-120858723 GAACACACTTTGATAAATACTGG + Intronic
1089909042 11:122077120-122077142 CAAAACATCTTGGACAATGCAGG + Intergenic
1091790104 12:3267244-3267266 TCAAACTCCTTGGAAAATGCAGG - Intronic
1092841888 12:12550340-12550362 GATCACACTTTGAAAACTGCTGG - Intronic
1095968009 12:47882562-47882584 GGACCCACCTTGCAAAATCCTGG + Intronic
1096319395 12:50598693-50598715 GAAGACATCTTGGAAGATGCTGG - Intronic
1097861043 12:64518962-64518984 GAACACATTTTGGGAAATACTGG + Intergenic
1098382686 12:69885446-69885468 GCCCACAGCTTGGAGAATGCAGG - Intronic
1098386061 12:69920058-69920080 GAACACAGCTTGGAAGCTCCTGG - Intronic
1103168261 12:118789693-118789715 GAACATATCTTAGAAATTGCTGG + Intergenic
1104716252 12:131018287-131018309 GCAGACACCTGGGAGAATGCGGG - Intronic
1106871047 13:34021145-34021167 GTAGACACCTTGGAAAATGCAGG - Intergenic
1107095498 13:36530847-36530869 GATCACACTTTGGAAATTACTGG + Intergenic
1107250627 13:38356926-38356948 AAACACACTTTGGCAACTGCTGG + Intronic
1108145350 13:47471046-47471068 GAAGTCAACTTGGAAAATGATGG + Intergenic
1108179099 13:47823293-47823315 AAACCCACCTTGGGAAATGCTGG + Intergenic
1114601644 14:23960139-23960161 GAGCACACCTTGCAAAGGGCGGG + Intronic
1114605814 14:23995264-23995286 GAGCACACCTTGCAAAGGGCAGG + Intronic
1115164241 14:30430093-30430115 AATCACACATTGGGAAATGCTGG + Intergenic
1117412174 14:55460526-55460548 GAAAACACTTTGGGAACTGCTGG + Intergenic
1117568241 14:57018686-57018708 GAACACATTTTGGGAAATACTGG - Intergenic
1117843030 14:59880793-59880815 CACCACAGCTTGGAATATGCTGG + Intergenic
1119927005 14:78504166-78504188 GAACACACTTTGGGAAACCCTGG + Intronic
1120182935 14:81364786-81364808 GGACACACTTTGGAAAATGCTGG + Intronic
1120544759 14:85797344-85797366 GAACAGTCCTTTGAAAATACAGG + Intergenic
1120751719 14:88204073-88204095 GTAGAGGCCTTGGAAAATGCAGG - Intronic
1120764232 14:88313951-88313973 GAACACATTTTGGGAAATGTTGG + Intronic
1121364856 14:93299796-93299818 GAAAGCTCTTTGGAAAATGCTGG - Intronic
1121796425 14:96739867-96739889 GAGAGTACCTTGGAAAATGCTGG - Intergenic
1122095715 14:99369995-99370017 GAACACACCTCAGAAATGGCTGG + Intergenic
1125856030 15:42950648-42950670 ACAGACACCTTGGAAAATGGTGG + Intronic
1126511164 15:49476476-49476498 AAACACACTTTGGAAATTGTAGG - Intronic
1128260720 15:66231158-66231180 GAACACAGGCTGGGAAATGCAGG + Intronic
1128449338 15:67794146-67794168 GACACCACCTTGGAAAATGCAGG + Intronic
1129003111 15:72350344-72350366 GAACTCACTTTGGACAATGGAGG - Intronic
1129513068 15:76139077-76139099 GTAAACACTTTGGAACATGCTGG + Intronic
1129717697 15:77861712-77861734 GACCACCCTTTGGAAAATGCTGG - Intergenic
1130019504 15:80215974-80215996 GAGCAGACCTTGGAAGATGCTGG - Intergenic
1130461066 15:84158534-84158556 GACCACCCTTTGGAAAATGCTGG + Intergenic
1130621091 15:85463170-85463192 GAACAGAACCTGGAAAATGTGGG + Intronic
1131286873 15:91066847-91066869 CAAAGCACCTTGGACAATGCTGG + Intergenic
1132366141 15:101258445-101258467 GGTATCACCTTGGAAAATGCTGG - Intergenic
1133422218 16:5655538-5655560 GAACCCACTTTGAAAAATTCTGG - Intergenic
1135013372 16:18903908-18903930 AGACATACCTTGGAAAATGGGGG - Intronic
1135320301 16:21491498-21491520 AGACATACCTTGGAAAATGGGGG - Intergenic
1135373136 16:21922988-21923010 AGACATACCTTGGAAAATGGGGG - Intergenic
1135438653 16:22447714-22447736 AGACATACCTTGGAAAATGGGGG + Intergenic
1136184552 16:28579088-28579110 GAACAAACTTTGTAAGATGCAGG + Intronic
1136330530 16:29573202-29573224 AGACATACCTTGGAAAATGGGGG - Intergenic
1136445157 16:30312922-30312944 AGACATACCTTGGAAAATGGGGG - Intergenic
1137707042 16:50542769-50542791 GAACATGCTTTGGAAAATACTGG - Intergenic
1137860700 16:51843622-51843644 GAGCTCACTTTGGGAAATGCTGG - Intergenic
1138098427 16:54231971-54231993 GAACTTACTTTGGGAAATGCTGG + Intergenic
1139130330 16:64134978-64135000 GAACAAAGTTTGGAAAATGTTGG + Intergenic
1141900961 16:86990040-86990062 GAAAAACCATTGGAAAATGCAGG - Intergenic
1142227954 16:88886552-88886574 CAACACAGCTGGGGAAATGCAGG + Intronic
1146085723 17:29827123-29827145 GAACACATATGGGTAAATGCTGG + Intronic
1146482926 17:33219613-33219635 GGACACAGTTTGGGAAATGCAGG - Intronic
1147132400 17:38417263-38417285 CAACACACCTTGAACACTGCAGG - Intergenic
1147568267 17:41550972-41550994 GAACATACACTGGAAAATCCAGG + Intergenic
1148766256 17:50040119-50040141 CAAAACAGCTTGGGAAATGCTGG - Intergenic
1149316420 17:55443098-55443120 GAATACACATTGGGAAATGCTGG - Intergenic
1149489449 17:57072303-57072325 GAACACACTTTGGGAAATGATGG + Intergenic
1152368754 17:79872012-79872034 GTCCACACCCTGGAAGATGCAGG + Intergenic
1154035741 18:10800159-10800181 GAACACAACTAGCAATATGCTGG + Intronic
1155671238 18:28374006-28374028 GGAAACACCATAGAAAATGCTGG - Intergenic
1157860883 18:51139113-51139135 TCACCCACCTTGGAAAATGAGGG + Intergenic
1158528322 18:58235060-58235082 GAACACACCTGGGAACATTCTGG - Intronic
1159107277 18:64016818-64016840 GAACATATCATGGAAAATGAGGG - Intergenic
1161324692 19:3657957-3657979 GAACCACCTTTGGAAAATGCTGG + Intronic
1163136456 19:15314875-15314897 GACCAGACCTTGGAAGATGGAGG + Intronic
1163205194 19:15797343-15797365 GAAGATACCTTGGAATAGGCTGG + Intergenic
1164722924 19:30445207-30445229 GAAGACACTTTGGCAAACGCCGG + Exonic
1164881304 19:31734776-31734798 GAACACATCTTTTAACATGCTGG + Intergenic
1165147091 19:33737750-33737772 GAAAACACATTGGAGAAGGCTGG - Intronic
925506218 2:4568443-4568465 GAACATACATTGGAAAAAGGAGG - Intergenic
926045511 2:9706820-9706842 GAATACATTTTGGAAAATGTTGG - Intergenic
926563857 2:14447747-14447769 GCACACAGCTTGGAAACTGCAGG - Intergenic
926693693 2:15755349-15755371 GACCGCCACTTGGAAAATGCTGG + Intergenic
929596397 2:43178991-43179013 GAACCCACCATGGGAAAAGCTGG + Intergenic
929631375 2:43466130-43466152 GGACACACTTTGGGAAATTCTGG - Intronic
930505581 2:52279589-52279611 GAACACAGCAAGGAAGATGCAGG + Intergenic
930563271 2:52987551-52987573 GAACACACCTTTTAAATTGTAGG - Intergenic
930606453 2:53498148-53498170 GAACTCACATGGGGAAATGCTGG + Intergenic
932315512 2:70779260-70779282 GAAACAACTTTGGAAAATGCTGG + Intronic
935198915 2:100838721-100838743 GAACACCCCTTTGAGAAGGCAGG - Intronic
935750950 2:106233267-106233289 CACCACAGCTTGGAAAATGCTGG - Intergenic
936758249 2:115740540-115740562 GAACACACTATATAAAATGCTGG + Intronic
937653737 2:124350469-124350491 GAACTGACCATGGAAAATGAAGG - Intronic
939277520 2:140018391-140018413 GGACACACCTTTGATAATCCTGG + Intergenic
940805262 2:158180178-158180200 GTCTCCACCTTGGAAAATGCAGG - Intronic
941315103 2:163982088-163982110 GTACACCTCTTGGAAAGTGCTGG - Intergenic
942665166 2:178309858-178309880 GCACACACTTTGGGGAATGCTGG - Intronic
942672261 2:178388611-178388633 GAAGACACCTTAGAAGAGGCTGG - Intronic
943353982 2:186828394-186828416 GAAGATACCTGGGAAAATGTTGG + Exonic
943559935 2:189448892-189448914 GAACACATTTTGAAAAATGTTGG + Intronic
1170519599 20:17170159-17170181 CAACACACTTTGAGAAATGCTGG + Intergenic
1170794532 20:19534831-19534853 GAAAACAGTTTGGAAAATGCTGG - Intronic
1171964121 20:31516506-31516528 GAGCACATCTGGGACAATGCAGG + Intronic
1172185102 20:33026635-33026657 CAACCCACATTGGAAACTGCAGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173128185 20:40359878-40359900 GAACACCCCTGGGAAGGTGCTGG - Intergenic
1176059471 20:63166087-63166109 GGATACACTTTGGGAAATGCTGG - Intergenic
1176702151 21:10067452-10067474 GAACAAACCTTGGAACAAACTGG - Intergenic
1183387962 22:37525903-37525925 GAGCTAACCCTGGAAAATGCTGG - Intergenic
1183478483 22:38050213-38050235 GACCACACTTTGGAAAGAGCCGG - Intergenic
949520286 3:4845805-4845827 GAAGACTCATTGGAAAATGGTGG - Intronic
951051391 3:18097811-18097833 GGACACACCTGGGATAATCCAGG + Intronic
951768569 3:26228686-26228708 GAACATACCCTGGAAAAGGTAGG + Intergenic
952219849 3:31314094-31314116 GAACACAGTTTGGAAAATCCTGG + Intergenic
952653604 3:35756829-35756851 AAGCACACCTTGCAGAATGCAGG + Intronic
953046494 3:39297882-39297904 TAACACACTTAGGAAAATTCAGG + Intergenic
955056137 3:55457629-55457651 GACCACACCTGGGAGAATCCTGG - Intergenic
955474861 3:59326315-59326337 GAAAACACATAGCAAAATGCTGG - Intergenic
956508660 3:69971229-69971251 GAACACAGTTTGGGAAATTCTGG + Intergenic
956963679 3:74433537-74433559 AAACACAACCTGGAAAATGCAGG + Intronic
957737274 3:84218290-84218312 GAACACACCTAGAAAAATAAGGG + Intergenic
957960367 3:87242243-87242265 AAACACACTTAGGAAAATGAAGG - Intronic
959250733 3:103940596-103940618 GAACATACATTGGAAAAAGGTGG - Intergenic
959519954 3:107314323-107314345 TAACACTCCATTGAAAATGCTGG - Intergenic
960322948 3:116260016-116260038 GAACATACTTGGGAAATTGCAGG - Intronic
961089461 3:124097597-124097619 TGACACACCTAGGAAAAGGCAGG + Intronic
962348179 3:134637523-134637545 AAACACCATTTGGAAAATGCTGG + Intronic
962937237 3:140092254-140092276 GAACACACTTTTGGACATGCTGG + Intronic
964132086 3:153300858-153300880 GAACACATTTGGGGAAATGCTGG + Intergenic
964230893 3:154466042-154466064 ACACACCCCTTGGAAAATGCTGG + Intergenic
964476317 3:157100695-157100717 GACAACACTTTGAAAAATGCTGG + Intergenic
964544436 3:157818149-157818171 GAATACACTTTGGAAAATGTTGG - Intergenic
964848924 3:161073069-161073091 GAACACACTTTGGGAAACACTGG - Exonic
964848945 3:161073344-161073366 GAACACCCTTTGGGAAATTCTGG + Exonic
964898558 3:161628677-161628699 TAAGACACCTTGGAATATCCTGG + Intergenic
965392123 3:168117841-168117863 GAACACATCTTTGCAAATGTTGG + Intergenic
967523545 3:190465265-190465287 GAACACAAAATGGAAAATGAGGG + Intergenic
969858345 4:10017770-10017792 GGACACATCTGGGGAAATGCGGG - Intronic
969858361 4:10017840-10017862 GGACACATCTGGGGAAATGCGGG - Intronic
969858375 4:10017910-10017932 GGACACATCTGGGGAAATGCGGG - Intronic
970580138 4:17467537-17467559 GATCCCACTTTGGAAAATTCTGG + Intronic
970710413 4:18855608-18855630 GGACCCACCTTGCAAAGTGCTGG - Intergenic
970955082 4:21801547-21801569 GAACACTGCTTGGAAAATGGTGG + Intronic
971215007 4:24654523-24654545 GAACATACTTCAGAAAATGCTGG - Intergenic
971251990 4:24980520-24980542 GAATTCACCTTATAAAATGCAGG - Intergenic
973340336 4:48996891-48996913 GAACACAGTTTGGGAAATGCTGG - Intronic
973859704 4:55050789-55050811 GAACACACCATGGCAAATTCAGG - Intergenic
974089165 4:57292849-57292871 GAAAATACTTTGGAAAAAGCAGG - Intergenic
974396590 4:61343854-61343876 AAACACACTTTGGGAAATACTGG + Intronic
974755763 4:66205151-66205173 GAACACACATTCCCAAATGCAGG + Intergenic
975868227 4:78748294-78748316 AAACACACTTTGGGAAATACTGG + Intergenic
976190322 4:82480700-82480722 GGACACACCTTAGCAAATGATGG + Intergenic
976257503 4:83113679-83113701 GGGGCCACCTTGGAAAATGCAGG + Intronic
976835720 4:89370931-89370953 GAACACACATTGCTAAATGAGGG + Intergenic
976972087 4:91116315-91116337 GAAACCACCATGGAAAATCCAGG + Intronic
980374327 4:131923741-131923763 GAACAAACCTTGGAACAAACTGG - Intergenic
981052416 4:140322470-140322492 GAACAAACATTGGAAACTGGAGG + Intronic
982102925 4:151986081-151986103 GAACAGATTTTGGAAAACGCTGG + Intergenic
983208711 4:164936868-164936890 AAACACACCATGGAAAATTTAGG + Intergenic
983633047 4:169869475-169869497 GAACACACCTTAGGAAATTTTGG - Intergenic
984516789 4:180751104-180751126 GAACAAACCTTGGAAATAGAAGG + Intergenic
985198669 4:187461388-187461410 GAAAACATTTTGGAAAGTGCTGG + Intergenic
985920006 5:2963063-2963085 CAACACACTGTGAAAAATGCTGG - Intergenic
986145205 5:5071466-5071488 GATCACACCTCAGAAAATTCTGG - Intergenic
986440767 5:7779706-7779728 GAACACAACTCTGAAAAAGCGGG + Intronic
987076850 5:14391015-14391037 GTACACAACTTGGAAAATTATGG - Intronic
988872395 5:35405549-35405571 CAACATTCCTGGGAAAATGCAGG - Intergenic
988948752 5:36236346-36236368 GAACACAACTTGGAAAACAGAGG - Intronic
989948213 5:50265082-50265104 TAACACATCTAGAAAAATGCAGG + Intergenic
991250046 5:64550025-64550047 GAACATATTTTGGAAACTGCAGG - Intronic
991373617 5:65942312-65942334 GAACATACCTAGGAAAATGCTGG - Intronic
991447164 5:66712426-66712448 AAACACACTTTGGAAAATCCTGG - Intronic
991950518 5:71943165-71943187 TAACACCGCGTGGAAAATGCAGG + Intergenic
992711432 5:79461419-79461441 AAACACACTTCGGGAAATGCTGG - Intronic
993090133 5:83415418-83415440 AAACACACCTTGGGAAATATTGG + Intergenic
993905879 5:93621922-93621944 GAATTCAACTTAGAAAATGCAGG + Intronic
993908623 5:93652838-93652860 AAACACACTTTGGAAAATTTTGG + Intronic
995909646 5:117170178-117170200 GAACACTACTTGGAACATGCTGG - Intergenic
997443956 5:133927753-133927775 GGATACATTTTGGAAAATGCTGG + Intergenic
998015383 5:138727540-138727562 GAAGACACTTTGGACAATCCTGG - Intronic
998481047 5:142463231-142463253 GATCACGCCTTGAAAAATGCTGG + Intergenic
999766727 5:154746668-154746690 GAAAGCCCTTTGGAAAATGCAGG + Intronic
1000286190 5:159828010-159828032 GAGCACACTTTGGGAAATGTTGG - Intergenic
1000970518 5:167709206-167709228 GAACTCAGCTTGGAAAAGACAGG - Intronic
1001172523 5:169433901-169433923 GAACACACTTTGGGAAATGCTGG - Intergenic
1001338655 5:170823649-170823671 GAACACATTTTGTGAAATGCTGG + Intergenic
1001699638 5:173697553-173697575 ACACACACTTTGGGAAATGCTGG - Intergenic
1003535749 6:6973907-6973929 GAACACGACCTGGAGAATGCAGG + Intergenic
1004475587 6:15968248-15968270 GAAAACACCATAGAAAATGGTGG - Intergenic
1009785757 6:68337223-68337245 GAACACAATTTGAAAAATGTTGG + Intergenic
1010072918 6:71765335-71765357 GAAGGCACCTTGGAAAATCAAGG + Intergenic
1010150097 6:72721495-72721517 GACCACAGTTTGGGAAATGCTGG - Intronic
1010247116 6:73671819-73671841 GAACTCAGCATGGAAAAAGCAGG - Intergenic
1010668537 6:78657905-78657927 GAAAAAAACTTGGAAAATACAGG - Intergenic
1011119909 6:83941127-83941149 GTACACACTTTGGGAAGTGCTGG + Intronic
1012170727 6:96015057-96015079 GACCAACCCTAGGAAAATGCAGG + Intergenic
1014657207 6:124122123-124122145 GAAGACAACTTGGAAAATGTTGG + Intronic
1015051172 6:128842135-128842157 GAAATAACCTTGGAAAATGAAGG - Intergenic
1016884361 6:148945539-148945561 GAACATACCTAGGGCAATGCTGG - Intronic
1017228402 6:152045997-152046019 GAGCACAACTTGCAAAGTGCTGG - Intronic
1017715853 6:157212523-157212545 GAATACACTTTGGAAAAAGCTGG - Intergenic
1018424625 6:163669187-163669209 AAACAAACTCTGGAAAATGCAGG - Intergenic
1022029400 7:26478798-26478820 GAACCCATCTTGGAAAATAATGG + Intergenic
1022925210 7:35049884-35049906 GACCACACCTTGCAAAATGCTGG + Intergenic
1023105387 7:36758934-36758956 GAGCACAGGTTGGGAAATGCAGG + Intergenic
1024822531 7:53350109-53350131 GAACACATCTTGGGTAATGAAGG + Intergenic
1027406436 7:77866461-77866483 GAACATACTTAGGAAAATACTGG + Intronic
1028103614 7:86851190-86851212 GAACACACCTTGGAAAATGCTGG + Intronic
1028476552 7:91260157-91260179 GAACACAGTTTGGAAAATGCTGG + Intergenic
1029794338 7:102877989-102878011 GAACACCCCTTGGGAAATGCTGG + Intronic
1029823227 7:103164575-103164597 GACCGCACCTTGCAAAATGCTGG + Intergenic
1032073968 7:128827547-128827569 GAACAGACCGTGCACAATGCTGG - Intergenic
1032112917 7:129091918-129091940 GAAAACACCTTGTAAACTGCAGG - Intergenic
1032518667 7:132525998-132526020 GTACACACCTTGGGAAATGCTGG + Intronic
1032916027 7:136491179-136491201 ATACACACCTTGGAGAATGTAGG - Intergenic
1035769390 8:2134759-2134781 GCACACACACTGGAAAAAGCAGG - Intronic
1037094923 8:14974631-14974653 GTTTACACCTTGGAACATGCTGG - Intronic
1040807773 8:51412787-51412809 GAACACACCTTGGTATAAACTGG - Intronic
1041698109 8:60759111-60759133 GAACACACTTTGAACACTGCTGG + Intronic
1042282095 8:67065411-67065433 CCAAACACCTTGGAAAATGCAGG + Intronic
1042443849 8:68860856-68860878 GAACACACTTTCCATAATGCTGG - Intergenic
1043302814 8:78755087-78755109 GAACATACATGGGAAAATGATGG - Intronic
1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG + Intergenic
1045022787 8:98059022-98059044 GAGCACACCATGCAAACTGCAGG + Intergenic
1045440709 8:102207046-102207068 GAACAAAGATTGGAAAAAGCTGG - Exonic
1045630241 8:104110863-104110885 AAACAAAGTTTGGAAAATGCTGG - Intronic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1046497551 8:115034847-115034869 GAACACACATTTGAAAATGTTGG - Intergenic
1046673786 8:117086640-117086662 GAATACACCTTGGCAGCTGCTGG - Intronic
1046755315 8:117967075-117967097 TAACACATCTTGGGAAATTCGGG + Intronic
1047468588 8:125144471-125144493 GAACAGACCTTAGACAATGCTGG + Intronic
1047719757 8:127628817-127628839 AAACACATTCTGGAAAATGCTGG - Intergenic
1048080194 8:131118364-131118386 TAACATACATTGGGAAATGCTGG + Intergenic
1048142955 8:131812853-131812875 GAACACAGCATGAAAAATGTTGG - Intergenic
1048698057 8:137050909-137050931 GAAGACACCATGGAAAATCAGGG - Intergenic
1052065934 9:24020141-24020163 GAAAACACCTTTCAAAATGAAGG - Intergenic
1052255567 9:26452424-26452446 GAACACAACCTGGAAAAGGGTGG - Intergenic
1053639297 9:40053862-40053884 GAACAAACCTTGGAACAAACTGG - Intergenic
1053766781 9:41411242-41411264 GAACAAACCTTGGAACAAACTGG + Intergenic
1054320100 9:63650526-63650548 GAACAAACCTTGGAACAAACTGG - Intergenic
1054545448 9:66322756-66322778 GAACAAACCTTGGAACAAACTGG + Intergenic
1054704995 9:68453038-68453060 CAGCACACATGGGAAAATGCTGG - Intronic
1056004953 9:82259096-82259118 GAACAACCTTTGGAAAATACAGG - Intergenic
1057705005 9:97389824-97389846 TTACACACCTTGGAAATTTCTGG + Intergenic
1058455814 9:105137296-105137318 GAACAAATTTAGGAAAATGCTGG - Intergenic
1058578921 9:106433743-106433765 GAACTCACCTAGGGAAATGTAGG + Intergenic
1059284760 9:113162841-113162863 GACCACACCAAGGAAAATCCAGG - Exonic
1059927401 9:119224337-119224359 GCATACAACTTGGCAAATGCTGG - Intronic
1202787168 9_KI270719v1_random:37537-37559 GAACAAACCTTGGAACAAACTGG - Intergenic
1185498006 X:572468-572490 AAACACACCCAGGAAAATGAGGG + Intergenic
1187827795 X:23350013-23350035 GAACACATTTTGGAAAATGGTGG - Intronic
1191995453 X:67090347-67090369 GAACAAACTTTGAAAAATGCTGG - Intergenic
1194326863 X:92529692-92529714 GAACATACTTTAGGAAATGCTGG - Intronic
1195398107 X:104432868-104432890 GAACACACTTTGAAAACTACTGG - Intergenic
1197318978 X:125005125-125005147 GAGCACACTTTTGATAATGCTGG - Intergenic
1197751448 X:129966624-129966646 GTCCACACCTTTGAAAATTCAGG + Intergenic
1197999207 X:132414435-132414457 GTACACACTCTGGCAAATGCTGG - Intronic
1198388822 X:136152919-136152941 AAGCACAGCTTGGAAAATTCAGG - Intronic
1198897362 X:141470310-141470332 AAACACAGTTTGGAAAGTGCTGG - Intergenic
1198941050 X:141955618-141955640 AAACACAGCTTGGAAACTCCTGG - Intergenic
1199373254 X:147076386-147076408 TAACACACTTTAGCAAATGCTGG + Intergenic
1199373345 X:147077622-147077644 GAACACACTTTAGCAAATGCGGG - Intergenic
1199668090 X:150118044-150118066 GAACATACTTTGGGAAATGCTGG + Intergenic
1199675479 X:150185667-150185689 GAACACACTTTGAGAACTGCTGG - Intergenic
1199806946 X:151309512-151309534 GAACACACCTAAAAAAATGCTGG - Intergenic
1200183638 X:154167488-154167510 GAACACAGGTTTGAAGATGCTGG + Intergenic
1200189292 X:154204616-154204638 GAACACAGGTTTGAAGATGCTGG + Intergenic
1200195047 X:154242425-154242447 GAACACAGGTTTGAAGATGCTGG + Intergenic
1200200697 X:154279546-154279568 GAACACAGGTTTGAAGATGCTGG + Intronic
1200635582 Y:5648901-5648923 GAACATACTTTAGGAAATGCTGG - Intronic
1202378189 Y:24256646-24256668 GACCAACCTTTGGAAAATGCTGG - Intergenic
1202492593 Y:25413475-25413497 GACCAACCTTTGGAAAATGCTGG + Intergenic