ID: 1028105709

View in Genome Browser
Species Human (GRCh38)
Location 7:86875842-86875864
Sequence TCTGGGGCCCAAAGCTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028105709_1028105714 25 Left 1028105709 7:86875842-86875864 CCATGATAGCTTTGGGCCCCAGA No data
Right 1028105714 7:86875890-86875912 TGGAGAAGCCAAGCAAAGTGAGG No data
1028105709_1028105713 5 Left 1028105709 7:86875842-86875864 CCATGATAGCTTTGGGCCCCAGA No data
Right 1028105713 7:86875870-86875892 TTAGTCAAGCGCTGTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028105709 Original CRISPR TCTGGGGCCCAAAGCTATCA TGG (reversed) Intergenic
No off target data available for this crispr