ID: 1028107355

View in Genome Browser
Species Human (GRCh38)
Location 7:86894928-86894950
Sequence CACTTCTATCACAAGTTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028107354_1028107355 -8 Left 1028107354 7:86894913-86894935 CCAATTTGATAAGAGCACTTCTA 0: 1
1: 0
2: 1
3: 19
4: 149
Right 1028107355 7:86894928-86894950 CACTTCTATCACAAGTTGTGCGG No data
1028107352_1028107355 13 Left 1028107352 7:86894892-86894914 CCCAGTATAGATTTTGGAGATCC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1028107355 7:86894928-86894950 CACTTCTATCACAAGTTGTGCGG No data
1028107353_1028107355 12 Left 1028107353 7:86894893-86894915 CCAGTATAGATTTTGGAGATCCA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1028107355 7:86894928-86894950 CACTTCTATCACAAGTTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028107355 Original CRISPR CACTTCTATCACAAGTTGTG CGG Intronic
No off target data available for this crispr